SGN Marker C2_At3g26060

SGN-M4665
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302141 (SGN)
121200 (CGN)
---
Capsicum annuumSingleSGN-U202267---
Lycopersicon CombinedMultipleSGN-U214003---
Solanum tuberosumSingleSGN-U258485---
ArabidopsisSingleAt3g26060 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41431)
Chromosome
7
Position
53.00 cM
Confidence
I
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43407
Forward primer (5'-3')
CCACCATTCACATTGAAAGATCAAGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GTCTGTCTACCAGGCAATGTACCAAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38517)
Chromosome
7
Position
28.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39740
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
250
Solanum pennellii TA56
190
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26313)
Chromosome
3
Position
9.53 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11154
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11155
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11156
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13268
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13269
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13270
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13271
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13272
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13273
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13274
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13275
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13276
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13277
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13278
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13279
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13280
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13281
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 33040
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33041
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33042
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 33043
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 11157
Forward primer (5'-3')
ATCAAGAACTTCAATTGTTGCTAAGG
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 190
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCAACCAGGAGTTTCATCAGCAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At3g26060 was used as an overgo probe on plate 13 [well D7]

Plausible BAC Matches:   P287B22,   P248P12

 Overgo Sequences

A sequence
AGCCTGTGGTGGTTTATTTCTACC
B sequence
GGAGTTTCATCAGCAGGGTAGAAA
AB sequence
AGCCTGTGGTGGTTTATTTCTACCCTGCTG
Marker sequence
ATGGCTTCTCTATCGGTCTCTGTAAAACACACTCTTCCTTCTCTGCTCCA
ATATGCTCAAACCCCAAAAAAACCCATCTCCCAAAACCTTACCATTGTCT
CCAGATCATCACAATCCCATTTTTATGGCCTTGAAGTCCTTCATTCACCT
TCTTTTTCAACCCCATCTTCTTCAAGAACTTCAATTGTTGCTAAGNNNNN
GTGAATAAAGGTTCAGCGCCTCCACCATTCACATTGAAAGATCAAGATGG
AAAAAATGTGAGTCTCTCCAAGTTTAAAGGAAAGCCTGTGGTGGTTTATT
TCTACCCTGCTGATGAAACTCCTGGTTGCACCAAACAGNNNNNGCATGTG
CCTTCAGGGACTCTTATGAAAAATTCAAGAAAGCAGGGGCTCAAGTTGTT
GGAATTAGTGGTGATGATATTGAATCCCACAAGNNNNNGCCTTTGCAAAG
AAGTACAGGCTCCCATTTACCTTGTTGTGTGATGAAGGCAACAAAGTTAG
GAAAGAGTGGGGAATCCCGGGAGACCTTTTTGGTACATTGCCTGGTAGAC
AGACTTATGTGCTTGACAAGAATGGAGTGGTTCAACTCATATATAATAAT
CAGTTCCAACCTGAAAAGCATATTGATGAGACATTGAAGTTACTTCAAAG
TCTTTAA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002056 plant #1, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At3g26060  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4665 marker 4665
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)