SGN Marker C2_At3g52730

SGN-M4666
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle303054 (SGN)
124122 (CGN)
---
Capsicum annuumSingleSGN-U204283---
Lycopersicon CombinedSingleSGN-U220568---
Solanum tuberosumSingleSGN-U251426---
ArabidopsisSingleAt3g52730 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38557)
Chromosome
11
Position
70.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39763
Forward primer (5'-3')
ATTATGGCGTTAAAACTCTCTGGG
Accessions and product sizes
Solanum lycopersicum TA209
2800
Solanum pennellii TA56
2800
Approximate temperature
55°C
Reverse primer (5'-3')
AACAGGCCGCTGTCCAAGAACTG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
900+1900
Solanum pennellii TA56
750+1300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26439)
Chromosome
3
Position
19.55 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11226
Forward primer (5'-3')
ATTATGGCGTTAAAACTCTCTGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGGCCGCTGTCCAAGAACTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 2800
Approximate temperature
55°C
  
PCR data   Exp. ID 11227
Forward primer (5'-3')
ATTATGGCGTTAAAACTCTCTGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGGCCGCTGTCCAAGAACTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 2800
Approximate temperature
55°C
  
PCR data   Exp. ID 11228
Forward primer (5'-3')
ATTATGGCGTTAAAACTCTCTGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGGCCGCTGTCCAAGAACTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2800
Approximate temperature
55°C
  
PCR data   Exp. ID 13301
Forward primer (5'-3')
ATTATGGCGTTAAAACTCTCTGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGGCCGCTGTCCAAGAACTG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 11229
Forward primer (5'-3')
ATTATGGCGTTAAAACTCTCTGGG
Digested band sizes (using MspI)
Solanum pennellii LA716: 750+1300
Solanum lycopersicum LA925: 900+1900
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AACAGGCCGCTGTCCAAGAACTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI, DraI
All possible enzymes for lycopersicum and pimpinellifolium: AluI, MspI, RsaI, HinfI
  
Accessions and product sizes
Solanum lycopersicum LA925: 2800
Solanum pennellii LA716: 2800
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At3g52730 was used as an overgo probe on plate 13 [well D8]

Plausible BAC Matches:   P257J07,   P189F10,   P149N09,   P196K07,   P224E17,   P238M13,   P210H01,   P243C24,   P170M09,   P285H02,   P215C21,   P070B10,   P144E07,   P113M14,   P212K03,   P092K09,   P054G09,   P111H20,   P276O11,   P002H09,   P139A06,   P274N24,   P111J11,   P220J22

 Overgo Sequences

A sequence
TGGAATCAGCTGCTAGAAGAAGTG
B sequence
TCAAGAACACCACCACCACTTCTT
AB sequence
TGGAATCAGCTGCTAGAAGAAGTGGTGGTG
Marker sequence
ATGGAATCAGCTGCTAGAAGAAGTGGTGGTGGTGTTCTTGAAGGATTTTA
CAGGCTGGTTATGCGCCGTACCCCTGTCTATGTTACCTTTGTCATCGCCG
GCGCTTTGCTCGGCGAACGGNNNNNGCAGTGGATTATGGCGTTAAAACTC
TCTGGGAGAAGAACAATGTTGGGNNNNNAAGCGTTACGAGGATATTTCAG
TTCTTGGACAGCGGCCTGTTGATGAATAA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At3g52730  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4666 marker 4666
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)