SGN Marker C2_At3g54770

SGN-M4671
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
Capsicum annuumSingleSGN-U200197---
Lycopersicon CombinedSingleSGN-U223092---
Solanum tuberosumSingleSGN-U253485---
ArabidopsisSingleAt3g54770 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49257)
Chromosome
4
Position
43.95 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47193)
Chromosome
4
Position
35.61 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46699)
Chromosome
5
Position
54.70 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38568)
Chromosome
4
Position
55.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39767
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
250
Approximate temperature
50°C
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
250
Solanum lycopersicum TA209
110
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26471)
Chromosome
3
Position
20.29 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11244
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
50°C
  
PCR data   Exp. ID 11245
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
50°C
  
PCR data   Exp. ID 11246
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
50°C
  
PCR data   Exp. ID 13323
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13324
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 13325
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13326
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13327
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 400
Approximate temperature
55°C
  
PCR data   Exp. ID 13328
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 280
Approximate temperature
55°C
  
PCR data   Exp. ID 13329
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 13330
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 13331
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 33060
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 480
Approximate temperature
55°C
  
PCR data   Exp. ID 33061
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 33062
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33063
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 11247
Forward primer (5'-3')
ACCGGAAGATCCAAAGGCTATGG
Digested band sizes (using EcoRV)
Solanum lycopersicum LA925: 110
Solanum pennellii LA716: 250
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGGGACGCGAGATTACAGTTGGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: EcoRV
  
Accessions and product sizes
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 250
Approximate temperature
50°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At3g54770 was used as an overgo probe on plate 13 [well E3]

Plausible BAC Matches:   P028I05,   P312A09,   P046M10,   P028E02,   P023F03,   P098K22,   P043B14,   P313O11,   P032B09,   P130G17,   P311A10

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GACGATGAGCAACATGGGTGATAC
B sequence
CACCTTTGTAAGCGTCGTATCACC
AB sequence
GACGATGAGCAACATGGGTGATACGACGCT
Marker sequence
ATGACGATGAGCAACATGGGTGATACGACGCTTACAAAGGTGTTTGTAGG
AGGGTTGGCATGGGAAACACCTAAGGAAGCCATGAAAGAACACTTTGACA
AGTATGGTGACATCTTGGAAGCTGTCATCATCTCCGATAAGATCACCGGA
AGATCCAAAGGCTATGGCTTTNNNNNGTGACCTTTAAGGATGCAGAATCA
GCCAAAAAAGCATGCGAGGATGCCACTCCAATTATCAACGGGCGCCGAGC
CAACTGTAATCTCGCGTCCCTCGGCGCCCGTCGTTCCCGCCCCTCTCCCT
CTATTACTCCCCCTCCTCCTCCTCCTCCTCAACAAGNNNNNGACCTAATG
TGGTTGGAGCAAGGGCTAATTCAGCATCACCTGCAAGTCACGTGCAGTGG
TACTATCCCCAAGCTGCACCTCCGGCTTCACCCTTTCACCATCATCAGCC
TCTTCCTTTCTATGGNNNNNGTATTCTCCAGCTTATATTGCCACAGACAT
GAACTACAATCATNNNNNAAAGTAAGCTACAATGGTGGGGGCTACGTGAA
TGGTCATTTTTCTCAAGTGTATCCAGGTCAGGCAATGATGCCAGTGTACC
ACCCATACTATCAGTTTCATCATCAGTCACAGACAATGGGCCTTCCAGCC
CATATCTATTCTCCAACACCTGCTGCCCCTATTCCAACCCTTATGTCAAA
GCCCACATCAANNNNNTTCCTCCTACTGCAGTTTGTTTGGCTGTGGAATA
G
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At3g54770  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4671 marker 4671
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)