SGN Marker C2_At4g29490

SGN-M4673
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle306923 (SGN)
130498 (CGN)
---
Capsicum annuumSingleSGN-U199794---
Lycopersicon CombinedMultipleSGN-U214068---
Solanum tuberosumSingleSGN-U246158---
ArabidopsisSingleAt4g29490 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38685)
Chromosome
7
Position
22.30 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39862
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
Accessions and product sizes
Solanum pennellii TA56
530
Solanum lycopersicum TA209
530
Approximate temperature
55°C
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
350
Solanum lycopersicum TA209
200+250
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26844)
Chromosome
4
Position
14.49 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11515
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 11516
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 11517
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 530
Approximate temperature
55°C
  
PCR data   Exp. ID 13477
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 510
Approximate temperature
55°C
  
PCR data   Exp. ID 13478
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13479
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13480
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13481
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13482
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 13483
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 13484
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13485
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 33115
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 33116
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 200
Approximate temperature
55°C
  
PCR data   Exp. ID 33117
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 150
Approximate temperature
55°C
  
PCR data   Exp. ID 11518
Forward primer (5'-3')
AAGAGCAAACTCGACATTGCACC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 200+250
Solanum pennellii LA716: 350
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAAGTAGGCGAAATAGCTCTCCTG
Enzymes
All possible enzymes for pennellii and and lycopersicum: TaqI
  
Accessions and product sizes
Solanum lycopersicum LA925: 530
Solanum pennellii LA716: 530
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At4g29490 was used as an overgo probe on plate 13 [well E7]

Plausible BAC Matches:   P112M13,   P120B09,   P251O12,   P290B10,   P169F22,   P308O12,   P272H07,   P069K12,   P049M11,   P048D18,   P058P20,   P054J09,   P158J17,   P197C14,   P037K05,   P153J18,   P166N17,   P149C03,   P308P13,   P138N20,   P108F03,   P196H16,   P119P02,   P308P12,   P313P01,   P001A24,   P302E19

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CGAGAGAAGCTCTTCAACTCTCTG
B sequence
AAGTGAGGTGGTTACGCAGAGAGT
AB sequence
CGAGAGAAGCTCTTCAACTCTCTGCGTAAC
Marker sequence
ATGTCTCCTCCGATGATTCGCATGGAACTCCATTCACTTAATCGAGAGAA
GCTCTTCAACTCTCTGCGTAACCACCTCACTTCATGCGCTCGTCCTCTCC
AAGGCTTTGTTCTCTTACAGNNNNNGGTGGCGAAGAGCAAACTCGACATT
GCACCGATCACCTAGAACTGTTCAGNNNNNACAGGAGAGCTATTTCGCCT
ACTTGTTTGGAGTGGAAGAGCCTGGATTTTACGGAACTATTNNNNNGATA
TAGCAAGTGGGAAATCTATGCTCTTTATTCCTAGGTTACCCGCTGACTAT
GCTGTTTGGATGGGAGAAATACAACCACCTTCTCACTTCCAGNNNNNGAA
AAGTACAAGGTTACCCAGGTCTTCTATACTGATGAGATTAAGGAAGTTTT
GGTTGATCAGTACCAAGCGACAGGAGCAGCATTACTATTTCTCTTGCATG
GGCTTAATACTGATAGCAACAAGTATTTTAAACCAGCAGAATTTCAGNNN
NNGGTATTGAGAAGTTCCAGACAGATCTAAGCACATTGCATCCTATCCTA
ACTGAATGCCGTGTTATAAAGTCCGATTTAGAGCTTGCTCTCATTCAATA
TGCAAATGACATAAGCTCTGAAGCTCATGTTGAGNNNNNGTTATGAGGAA
AACAAAAGTAGGGATGAAAGAATATCAGTTAGAAAGCATGTTTCTTCACC
ATACCTACATGTATGGCGGCTGTAGGCATTGTTCATACACATGTATATGT
GCTACTGGCGATAATAGNNNNNTGCTGTACTCCATTATGGTCATGCAGCA
GCTCCAAATGACAAGNNNNNACATTGCAAGAGGGAGATATGGCACTTCTA
GATATGGGAGCTGAGTACCACTTTTATGGGTCCGACATAACTTGTTCCTT
TCCANNNNNGTAAATGGGAAATTTACTCGTGACCAGTCACTTTTATATAC
TGCTGTTCTTGATGCTCATGATGCTGTCATTTCTGCCATGAAGCCTGGAG
TGAGCTGGGTCGATATGCATAAATTAGCTGAAAGGGTCATTTTGGAATCA
CTGAAGAAAGGGAACCTACTTGTTGGGGATGTTGATAAAATGATGGCCGA
GCGACTTGGTGCTGTTTTCATGCCTCATGGATTGGGGCACCTTCTTGGAA
TTGATACTCATGATCCTGGGGGTTACTTGAAGGGAGCTAAAAGACCAAAA
GAACCTGGATTGAGCTCTCTACGTACGAGCAGAAAGCTCTTAAAGGGAAT
GGTGATCACTGTGGAGCCTGGTTGTTACTTCATTGATGCCTTGCTACTTC
CTGCCTTGAAGAGTCCAGCAGTTTCAGAGTTTTTCAATCGTGTTGAGATC
AACAGGTTTAGACCTTTTGGTGGAGTCAGAATTGAAAGTGATGTGTGTGT
TACTTCCATTGGATGCATTAACATGAGCAAATGTCCGCGGAAGATTGAAG
AGATAGAGGCAGTGATGGCGGGGGCTCCTTGGCCGATAGAAAAGACTACC
TTTCTATCTGGAAATGGACAAGTGTAATTCTCCCAAATATTGCATGACAT
CAAGAAACTAGAATAA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At4g29490  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4673 marker 4673
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)