SGN Marker C2_At3g15290

SGN-M4674
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309818 (SGN)
131802 (CGN)
---
Capsicum annuumSingleSGN-U197340---
Lycopersicon CombinedSingleSGN-U219933---
Solanum tuberosumMultipleSGN-U244533---
ArabidopsisSingleAt3g15290 on TAIR---
Mapped locations  
Map: Solanum michoacanum 2011   
Map version
155 (location: 109233)
Chromosome
7S
Position
51.53 cM
Confidence
uncalculated
Protocol
CAPS


Solanum michoacanum 2011

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46666)
Chromosome
7
Position
19.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46484)
Chromosome
7
Position
32.60 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41416)
Chromosome
7
Position
107.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43392
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38468)
Chromosome
7
Position
63.50 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39708
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
Accessions and product sizes
Solanum pennellii TA56
1200
Solanum lycopersicum TA209
1100
Approximate temperature
55°C
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1100
Solanum pennellii TA56
1200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26175)
Chromosome
3
Position
5.15 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11055
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 11056
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 11057
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13216
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13217
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13218
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 13219
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13220
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13221
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13222
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13223
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13224
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13225
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13226
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1350
Approximate temperature
55°C
  
PCR data   Exp. ID 13227
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33024
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33025
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33026
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33027
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 11058
Forward primer (5'-3')
TCTGCTATTTTGGCTTCTAATACAAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 1200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACAATATGTGTCTTCTGATGTATCTGC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 1200
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At3g15290 was used as an overgo probe on plate 13 [well E8]

Plausible BAC Matches:   P032P02,   P046G04

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TGATGCTGTGAAGCGTCTTCGTTG
B sequence
ATCCAAGCGCGAAGAACAACGAAG
AB sequence
TGATGCTGTGAAGCGTCTTCGTTGTTCTTC
Marker sequence
ATGGCCGATATAACAAGGATCGGAGTTGTTGGCGCCGGCCAAATGGGTGC
CGGAATCGCCCAACTCGCCGCCGTCAACGGCGTCGACGTTTGGCTTTACG
ATTTGGATTCTGAAGCTCTTACTAAAGCTCAAAAATCTATTTCCAATAAT
ATTCAACGCCTCCTCACCAAAGGACAAATCTCTCAGNNNNNGCAACGAGT
GTTGATGCTGTGAAGCGTCTTCGTTGTTCTTCGCGCTTGGATGATTTACA
GTCAGTTGATATTGTTGTTGAGGCTATTGTGGAGTCTGAACAAGTGAAGA
AATCTTTATTTGCTAACTTGGATAAGATTGTAAAGAGTTCTGCTATTTTG
GCTTCTAATACAAGCTCTATTTCCATTACTCGTCTAGCATCTGCAACGAG
CCGACCCTCTCAGNNNNNGTGATCGGCATGCACTTTATGAATCCTCCGCC
GATTATGAAGCTGGTTGAAATTATTCGGGGTGCAGATACATCAGAAGACA
CATATTGTGCCACTAAATGCCTGGCAGAGAGNNNNNGTTTGGTAAGACAG
TTATCTGCTCTCAGGATTACTCTGGTTTCATAGTAAACCGAATTTTGATG
CCAATGATAAACGAAGCCTTTCATACACTGTACACCGGAGTTGCAACAAA
AGAAGATATCGATACAGGAATGAAACTAGGAACCAACCATCCTATGGGTC
CTTTTGAACTTGCAGATTTTATCGGACTGGATGTTTGTTTGTCAATCATG
AAAGTTTTTCAAGCCGGTTTAGGGGACGATAAATATGCCCCATGCCCTCT
CCTTGTGCAGTATGTTGATGCTGGTAGACTTGGTAAAAAACGAGGGGTTG
GGGTATATGATTACCGTAATGCTGGTAAAAAAACAGGAGGATCGCCTCGA
CTTTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At3g15290  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4674 marker 4674
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)