SGN Marker C2_At1g74970

SGN-M4675
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle310719 (SGN)
126534 (CGN)
---
Capsicum annuumSingleSGN-U203855---
Lycopersicon CombinedSingleSGN-U219328---
Solanum tuberosumSingleSGN-U245738---
ArabidopsisSingleAt1g74970 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38262)
Chromosome
4
Position
109.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39532
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
Accessions and product sizes
Solanum lycopersicum TA209
1000
Solanum pennellii TA56
1000
Approximate temperature
55°C
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
850
Solanum pennellii TA56
550
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25467)
Chromosome
1
Position
28.16 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10422
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 10423
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 10424
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12813
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1700
Approximate temperature
55°C
  
PCR data   Exp. ID 12814
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12815
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1500+2500
Approximate temperature
55°C
  
PCR data   Exp. ID 12816
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12817
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12818
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 2500
Approximate temperature
55°C
  
PCR data   Exp. ID 12819
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 2500
Approximate temperature
55°C
  
PCR data   Exp. ID 12820
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12821
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12822
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12823
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 12824
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1600
Approximate temperature
55°C
  
PCR data   Exp. ID 12825
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 12826
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32849
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32850
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 32851
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 2500
Approximate temperature
55°C
  
PCR data   Exp. ID 32852
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 2500
Approximate temperature
55°C
  
PCR data   Exp. ID 10425
Forward primer (5'-3')
TCATCATCAACTATCGTGATGCTAAG
Digested band sizes (using AluI)
Solanum lycopersicum LA925: 850
Solanum pennellii LA716: 550
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACGCTTGCGAGCCTTCTTGAGAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, DraI, HaeIII, HinfI; DpnII
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g74970 was used as an overgo probe on plate 13 [well E9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCTTGCTCATTCGAAGCAATTCTC
B sequence
GGAAGCGAGAGAGAAAGAGAATTG
AB sequence
CCTTGCTCATTCGAAGCAATTCTCTTTCTC
Marker sequence
ATGGCGATTTCCGTGGCTTCTCTTGCTTCATCTTTTGCTTCCCTTTCATT
TTCTTCTCAGATTTCTCAAAAACCCTATGCTGTATCCCTTGCTCATTCGA
AGCAATTCTCTTTCTCTCTCGCTTCCAAAATCTCTACGCTTGTAGTGTCA
GCTTCTGTTGCTGAAGCACCGGAGACGGAGGAATTGGAAACCAGAGAGAA
TCTTTTGAAGCTTGTGAAAAGTAGACTTCCTGGAGGTTTCGCTGCACAGC
CTATTTTTGGAACTGGTAGACGTAAAAGTGCTAGTGCTCGTGTTGTTCTT
CAGGAAGGTTCTGGAAAAATCATCATCAACTATCGTGATGCTAAGNNNNN
GAATATCTTCAAGGAAATCCATTATGGATTCAATATGTCAAAACTCCACT
GGCCACTTTAGGATATGAGGCTAGTTATGACATTTTTGTCAAGGTGGAAG
GCGGTGGTCTTTCTGGGCAGGCTCAAGCAATTTCCCTTGGCATTGCTCGT
GCACTCCTAAAGGTTAGTGAGAGCCATAGAAAACCATTGAGGGAGGAGGG
TCTGTTAACTAGAGATGCCAGAGTTGTTGAGCGGAAGAAAGTTGGTCTCA
AGAAGGCTCGCAAGCGTCCACAATTTTCCAAGCGTTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text

Genomic location of C2_At1g74970  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4675 marker 4675
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)