SGN Marker C2_At2g40760

SGN-M4678
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302091 (SGN)
125183 (CGN)
---
Capsicum annuumSingleSGN-U205370---
Solanum tuberosumSingleSGN-U248976---
ArabidopsisSingleAt2g40760 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38380)
Chromosome
3
Position
74.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39630
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
Accessions and product sizes
Solanum lycopersicum TA209
250
Solanum pennellii TA56
250
Approximate temperature
55°C
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
200
Solanum pennellii TA56
220
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25899)
Chromosome
2
Position
17.02 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10837
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10838
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 10839
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 250
Approximate temperature
55°C
  
PCR data   Exp. ID 13079
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13080
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13081
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13082
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13083
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13084
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13085
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13086
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13087
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 13088
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32623
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32964
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32965
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32966
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32967
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 32968
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 300
Approximate temperature
55°C
  
PCR data   Exp. ID 10840
Forward primer (5'-3')
AGGAAGAGGCTCTTCATCATGGAC
Digested band sizes (using RsaI)
Solanum pennellii LA716: 220
Solanum lycopersicum LA925: 200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTCTCAATTGGTGAAACAGAAGG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI,MspI,RsaI,DraI,TaqI,RV,HinfI,DpnII,KpnI
  
Accessions and product sizes
Solanum pennellii LA716: 250
Solanum lycopersicum LA925: 250
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At2g40760 was used as an overgo probe on plate 13 [well F1]

Plausible BAC Matches:   P251N03,   P019A16,   P054K19,   P023A23,   P317D09,   P050P05

 Overgo Sequences

A sequence
GAGGAGGTTGAAGGTAGCGTTTTG
B sequence
GTTGTGATTCGGAGCTCAAAACGC
AB sequence
GAGGAGGTTGAAGGTAGCGTTTTGAGCTCC
Marker sequence
ATGCTATCATCATCAACCGCCTTTTCACCAAACCCTAATCTTCCCATTAA
TTCACTCCATTGCACCATGAAAGCAACATCTGAACTACCTACAAAACCCC
CTAACTTTCCTTTCTTTTCTAATCCTAAGATTACTATAACCAATTTACCG
CAAAACCTTGCACCCTCTAACTGTTTCTCTGCAACAAATCCTGTTCCCAT
TCTGAAGGCTAATGCATCGAGGAACGAGGAGGTTGAAGGTAGCGTTTTGA
GCTCCGAATCACAACTTGTGGTGGTTTCTTTCTACAAATTTGCTGATTTT
CCTGACCATGCTGATTTGAGGAAACCATTGAAGGAACTTTGTGAAAAACT
NNNNNNGGTGGTATTATTCTTGCACCTGAAGGAATCAATGGCAGCATATG
CGGAAGACGGGATTCAGTGGAAACTGTTCTTGCATTCATTCAAAGTGATG
AGCGTCTGAAGGGGCTTAGATTGATCGAGTCACCAGTGAGCCCGGAGGAA
GAGGCTCTTCATCATGGACATATGAGCAGCTCTCCTCTTGCAGCGGGTGA
GGATGCTCCCTTTAGGTGGGATCACGTGAGGGTGAAGCTCAAAAAAGAGN
NNNNATAGTTACACTTGGAATGCCTTCTGTTTCACCAATTGAGAGAGTTG
GCAAGTACATTAAACCGACAGAGTGGAATGCATTGATTAGTGATCCAGAT
GTTNNNNNGTGNNNNN
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text


BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3 (2), plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g40760  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4678 marker 4678
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)