SGN Marker C2_At5g56130

SGN-M4683
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle307866 (SGN)
128346 (CGN)
---
Capsicum annuumSingleSGN-U201794---
Lycopersicon CombinedSingleSGN-U223085---
Solanum tuberosumSingleSGN-U248284---
ArabidopsisSingleAt5g56130 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46779)
Chromosome
7
Position
50.80 cM
Confidence
CF(LOD3)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Eggplant-COSII   
Map version
63 (location: 42262)
Chromosome
7
Position
111.60 cM
Confidence
I
Protocol
dCAPS


Eggplant-COSII

PCR data   Exp. ID 43831
Forward primer (5'-3')
CTTCGTCCTCTTTCTACTGCATGAAT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TAGGTTTAAACTTGCGAACATCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38893)
Chromosome
7
Position
108.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39995
Forward primer (5'-3')
ACATATAGCTGTTGGGAACAGGG
Accessions and product sizes
Solanum pennellii TA56
350
Solanum lycopersicum TA209
350
Approximate temperature
55°C
Reverse primer (5'-3')
TAGGTTTAAACTTGCGAACATCC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
220
Solanum lycopersicum TA209
300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27564)
Chromosome
5
Position
22.74 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 12027
Forward primer (5'-3')
ACATATAGCTGTTGGGAACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGTTTAAACTTGCGAACATCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12028
Forward primer (5'-3')
ACATATAGCTGTTGGGAACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGTTTAAACTTGCGAACATCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12029
Forward primer (5'-3')
ACATATAGCTGTTGGGAACAGGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGTTTAAACTTGCGAACATCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 12030
Forward primer (5'-3')
ACATATAGCTGTTGGGAACAGGG
Digested band sizes (using RsaI)
Solanum pennellii LA716: 220
Solanum lycopersicum LA925: 300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TAGGTTTAAACTTGCGAACATCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI
All possible enzymes for lycopersicum and pimpinellifolium: RsaI
  
Accessions and product sizes
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 350
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
C2_At5g56130 was used as an overgo probe on plate 13 [well F10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTAAAGGGTCACACCGACAGTGTG
B sequence
CCCAACATAACTGGTCCACACTGT
AB sequence
TTAAAGGGTCACACCGACAGTGTGGACCAG
Marker sequence
ATGGCGGAAACAATACCCTTCAAAAATCTTCATAGCAGAGAGTACCAGGG
ACACAAGAAGAAGNNNNNGTGCATTCGGTGGCATGGAACTGCAGTGGCAC
GAAATTAGCTTCAGGTTCTGTGGATCAAACAGCTCGTATTTGGCAAATTG
AGCCTCATGGTCATNNNNNGGAAAGGTAAAAGATGTTGAATTAAAGGGTC
ACACCGACAGTGTGGACCAGTTATGTTGGGATCCAAAACATGCAGAATTG
ATAGCTACAGCATCTGGTGACAAGACAGTTCGATTATGGGATGCCCGTAN
NNNNGTGGGAAATGCTCACAGCAAGTTGAACTCAGTGGGGAAAATATCAA
TATCACTTACAAGCCTGATGGGACACATATAGCTGTTGGGAACAGGNNNN
NGATGATGAGCTAACAATCTTGGATGTTCGCAAATTTAAGCCTATTCATA
AGCGCAAGTTTAATTATGAGNNNNNGTAAATGAGATTGCATGGAACACGG
GTGGCGATATGTTCTTTCTTACAACTGGAAATGNNNNNGAACTGTGGAAG
TCTTAGCTTATCCGTCTCTACAAGCTGTTAACACGCTTAATGCTCACACT
GCTGGTTGTTACTGCATTGCAATTGATCCACTAAGAAGNNNNNATATTTT
GCTGTTGGAAGTGCTGATTCATTGGTCAGCCTTTGGAGCATCAAGGAGAT
GCTATGTCTTCGAACATTTACAAAACTTGANNNNNGTGGCCAGTTCGGAC
AATAAGTTTCAATCACACAGGAGACTACATTGCCTCTGCTAGTGAAGATT
TGTTTATTGATATTNNNNNGCTAATGTCCAATCTGGACGGTCAGTTCACC
AAATTCCATGTCGTGCTGCCATGAACAGTGGTGAATGGAATCCAAAACAC
AACTTGCTTGCCTTTGCCGGGGATGATAAGAACAAATACCAGGCTGATGA
AGNNNNNGTGTGTTTCGCATATTTGGCTTTGAGAGCGCATAG
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At5g56130  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4683 marker 4683
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)