SGN Marker C2_At1g02560

SGN-M4690
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302384 (SGN)
122925 (CGN)
---
Capsicum annuumSingleSGN-U197522---
Lycopersicon CombinedMultipleSGN-U214371---
Solanum tuberosumSingleSGN-U247742---
ArabidopsisSingleAt1g02560 on TAIR---
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41284)
Chromosome
1
Position
209.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43260
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38051)
Chromosome
1
Position
115.70 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39355
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
750
Approximate temperature
53°C
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
750
Solanum pennellii TA56
300+450
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24877)
Chromosome
1
Position
0.54 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 9885
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
53°C
  
PCR data   Exp. ID 9886
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
53°C
  
PCR data   Exp. ID 9887
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
53°C
  
PCR data   Exp. ID 12359
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 900
Approximate temperature
55°C
  
PCR data   Exp. ID 12360
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12361
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750+900
Approximate temperature
55°C
  
PCR data   Exp. ID 12362
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 600+750
Approximate temperature
55°C
  
PCR data   Exp. ID 12363
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 600+750
Approximate temperature
55°C
  
PCR data   Exp. ID 12364
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 400+600
Approximate temperature
55°C
  
PCR data   Exp. ID 12365
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12366
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12367
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12368
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 32589
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 32667
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 32668
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 32669
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750+900
Approximate temperature
55°C
  
PCR data   Exp. ID 32670
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 600+750
Approximate temperature
55°C
  
PCR data   Exp. ID 32671
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 600+750
Approximate temperature
55°C
  
PCR data   Exp. ID 9888
Forward primer (5'-3')
TTTATCTTGATGCTGTTGATCCCAC
Digested band sizes (using RsaI)
Solanum pennellii LA716: 300+450
Solanum lycopersicum LA925: 750
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGACCCTCCTGGAGAATTGACATAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, TaqI
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
53°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g02560 was used as an overgo probe on plate 13 [well G8]

Plausible BAC Matches:   P168D02,   P269B10,   P174D09,   P331M09,   P263A16,   P005L21,   P164H04

 Overgo Sequences

A sequence
GAGGTGACTGGGATTTAGCAAAGG
B sequence
CCAGAAGAACGTGAAGCCTTTGCT
AB sequence
GAGGTGACTGGGATTTAGCAAAGGCTTCAC
Marker sequence
ATGGCTCATTCTTGCATAGCCACAACTTCATCTCTCTCTAAATACAATTC
CGCAATTTTCCCATCTGATTATTGCAATATTTCTCCCATATCTCTACAGT
TTAAACGTCTTTCTTTNNNNNGAGGAAAGTAAAGGCTGTTGGGAAAGTGA
AAAGTAGGGGAAATAGCACCGTCAAGGCTGTGTATTCTGGAGGTGACTGG
GATTTAGCAAAGGCTTCACGTTCTTCTGGAATTTGGTCTATCAGNNNNNA
GATGACGTGCAAATACCATCATCACCTTATTTTCCTACATATGCCGCCCA
AGGTCAAGGACCACCGCCAATGGTACAAGAACGATTTCAGAGTGTGATCA
GCCAGCTCTTTCAATATNNNNNAGGATCATACGATGTGGTGGAGCAGTTG
ATGATGATATGGCTAATGTCATAGTTGCTCAGCTTCTTTATCTTGATGCT
GTTGATCCCACAAAGNNNNNGACATTGTTATGTATGTCAATTCTCCAGGA
GGGTCAGTAACAGCAGNNNNNGAATGGCTGTTTTTGATACCATGCGACAT
ATTCGACCCGATGTCTCAACTGTCTGTGTTGGACTCGCTGCAAGNNNNNT
ATGGGGGCTTTTCTTCTCAGTGCTGGCACTAAAGNNNNNGGAAGAGATAT
AGCTTGCCAAATTCAAGGATAATGATTCACCAGCCTCTAGGTGGTGCTCA
AGGTGGTCAAAGTGATATAGAAATACAGNNNNNGCTAATGAGATGTTGCA
TCACAAAGCAAATTTGAATGGTTACCTTGCCTACCAGACTGGTCAAAGCC
TTGATAGGATTAATCAGGATACTGATCGTGATTTTTTCATGAGCGCAAAG
GAAGCTAAGGAGTACGGGCTAATCGATGGTGTCATCATGAATCCAATGAA
AGCCCTTCAACCACTTGCAGCAGCTGCTGAACAATCGTAG
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At1g02560  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4690 marker 4690
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)