Notice: Due to a server issue, SGN was unavailable earlier today. We apologize for any inconvenience.

SGN Marker C2_At5g20890

SGN-M4692
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301331 (SGN)
120522 (CGN)
---
Capsicum annuumSingleSGN-U197719---
Lycopersicon CombinedSingleSGN-U221520---
Solanum tuberosumSingleSGN-U248914---
ArabidopsisSingleAt5g20890 on TAIR---
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 38810)
Chromosome
11
Position
76.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39942
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
Accessions and product sizes
Solanum pennellii TA56
1400
Solanum lycopersicum TA209
1400
Approximate temperature
55°C
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1350
Solanum pennellii TA56
1400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27247)
Chromosome
5
Position
7.09 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11778
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 350+750
Approximate temperature
55°C
  
PCR data   Exp. ID 11779
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11780
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13774
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13775
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13776
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13777
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13778
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13779
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13780
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13781
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 33228
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 33229
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33230
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 33231
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 11781
Forward primer (5'-3')
AACTTATCGAGGAGATCATGATTGG
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 350
Solanum pennellii LA716: 650
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTGAGCAATCAGCTCAGCACTGTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: DraI, TaqI, HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 350+750
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g20890 was used as an overgo probe on plate 13 [well G10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TATGGTGCACGTGTTCGAGTTGAC
B sequence
CAACCTTGGCCATTGAGTCAACTC
AB sequence
TATGGTGCACGTGTTCGAGTTGACTCAATG
Marker sequence
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAGATGAAGGNNNN
NGTTTATTTTGGACAAAAAGATTGGGGTTGGCCAACCAAAACGCATAGAA
AATGCTAAGATTTTGGTGGCAAATACTGCTATGGATACAGATAAAGTGAA
GATATATGGTGCACGTGTTCGAGTTGACTCAATGGCCAAGGTTGCTGATC
TAGAAGCAGCTGAAAAGGAAAAAATGAGAGAGAAGGTGCAAAAGATCATT
AGTCATGGAATAAATTGCTTTGTTAACCGACAGCTGATCTACAATTTCCC
AGAGGAACTATTTGCTGATGCTGGGATACTTGCAATAGAGCATGCTGACT
TTGATGGTATTGAGCGGTTGGGCTTAGTTACTGGGGGAGAAATTGCATCA
ACCTTTGATAACCCAGAGTCTGTCAAACTTGGCCACTGCAAACTTATCGA
GGAGATCATGATTGGCGAAGATAAGCTGATCCACTTCTCTGGGGTTGCAA
TGGGACAGGCATGTACAATTGTTCTGAGAGGTGCAAGNNNNNCCCTCATG
TACTGGATGAAGCTGAAAGATCTCTGCACGATGCATTGTGTGTACTATCT
CAGACGGTAAATGACAGCAGGGTTCTACTTGGAGGTGGATGGCCCGAGAT
GGTGATGGCTAAGGCGGTTGATGAACTAGCTAAGAAGACTCCAGGTAAAA
GGTCTCATGCAATTGAGGCTTTCACCCGTGCACTTCTGGCAATTCCAACC
ACCATTGCCGACAATGCTGGGTTAGACAGTGCTGAGCTGATTGCTCAGCT
TCGTGCTGAACACCACAAGGACGAAAGTAATGCAGGAATTGATGTCATCT
CTGGATCTNNNNNGTCGGAGATATGTCAGAGCTAGGAATATCCGAATCAT
TCAAAGTCAAACAGGCAGTATTGCTCTCTGCCACTGAGGCTGCTGAGATG
ATCCTAAGGGTTGACGAGATCATCACTTGCGCCCCACGGAGGAGGGAGGG
AATGTAA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text

Genomic location of C2_At5g20890  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4692 marker 4692
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)