SGN Marker C2_At1g07080

SGN-M4694
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle300364 (SGN)
119605 (CGN)
---
Capsicum annuumSingleSGN-U197797---
Lycopersicon CombinedMultipleSGN-U216215---
Solanum tuberosumSingleSGN-U247392---
ArabidopsisSingleAt1g07080 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132171)
Chromosome
6
Position
31.33 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Pepper-COSII   
Map version
58 (location: 41290)
Chromosome
6
Position
130.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43266
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38070)
Chromosome
6
Position
3.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39371
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
Accessions and product sizes
Solanum pennellii TA56
650
Solanum lycopersicum TA209
650
Approximate temperature
53°C
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
200+300
Solanum lycopersicum TA209
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 24929)
Chromosome
1
Position
2.17 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 9943
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Approximate temperature
53°C
  
PCR data   Exp. ID 9944
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Approximate temperature
53°C
  
PCR data   Exp. ID 9945
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 650
Approximate temperature
53°C
  
PCR data   Exp. ID 12374
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 400+750
Approximate temperature
55°C
  
PCR data   Exp. ID 12375
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 12376
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300+650
Approximate temperature
55°C
  
PCR data   Exp. ID 12377
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 12378
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 12379
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 12380
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Physalis TA1367: 300+500
Approximate temperature
55°C
  
PCR data   Exp. ID 12381
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12382
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 12383
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 600
Approximate temperature
55°C
  
PCR data   Exp. ID 32591
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32675
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32676
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32677
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 300+650
Approximate temperature
55°C
  
PCR data   Exp. ID 32678
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32679
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 9946
Forward primer (5'-3')
TTGTGCCATGGGTTGTTGTTGATG
Digested band sizes (using HinfI)
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 200+300
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGTAAGCTTTGCAAATGTAGCTTATG
Enzymes
All possible enzymes for pennellii and and lycopersicum: RsaI, HinfI, DpnII, KpnI
All possible enzymes for lycopersicum and pimpinellifolium: RsaI, HinfI, DpnII, KpnI
  
Accessions and product sizes
Solanum pennellii LA716: 650
Solanum lycopersicum LA925: 650
Approximate temperature
53°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At1g07080 was used as an overgo probe on plate 13 [well H1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTGTGCCATGGGTTGTTGTTGATG
B sequence
GTGTAAAGCGGTTGTCCATCAACA
AB sequence
TTGTGCCATGGGTTGTTGTTGATGGACAAC
Marker sequence
NNNNNAATTTGNNNNNAATGAACACTTCCCTTTTATTCACTGTGTGGAAA
GTTTGATCTACCATAAGAATTATACACAATGGGAAACGTGTTTCGAAAAA
CTGAATTTGAGGAAAAAACTCGTTACTGATTGTGTTGGCAGTGACAGAGG
CAAAGAGNNNNNCTTGAACTACGCCACGCAGCTGAGACACCTCCGCATAA
ATTTGTGCCATGGGTTGTTGTTGATGGACAACCGCTTTACACTNNNNNGA
CTACAGGGAATTCATAAGCTACATTTGCAAAGCTTACAAAGGAACCGCGC
CTATCCCCGGTTGTAGCTCATCTGATTCTATAAGTTTCACTTCCAAGTTA
TCAACTATCAGTTCAACAATTACATCATTTGTTGCACAGAGAGTTAAGCT
TGCTGCATCTGCATAA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At1g07080  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4694 marker 4694
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)