SGN Marker C2_At5g37360

SGN-M4695
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle308912 (SGN)
126457 (CGN)
---
Capsicum annuumSingleSGN-U202689---
Lycopersicon CombinedSingleSGN-U219292---
Solanum tuberosumMultipleSGN-U248077---
ArabidopsisSingleAt5g37360 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49298)
Chromosome
4
Position
46.42 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47238)
Chromosome
4
Position
35.63 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46766)
Chromosome
5
Position
56.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46534)
Chromosome
5
Position
50.80 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38848)
Chromosome
4
Position
56.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39958
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
Accessions and product sizes
Solanum lycopersicum TA209
1300
Solanum pennellii TA56
1200
Approximate temperature
55°C
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
1300
Solanum pennellii TA56
1200
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27353)
Chromosome
5
Position
14.82 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11861
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 11862
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 11863
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13847
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1500
Approximate temperature
55°C
  
PCR data   Exp. ID 13848
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1250
Approximate temperature
55°C
  
PCR data   Exp. ID 13849
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13850
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13851
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13852
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13853
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1200+1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13854
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13855
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13856
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13857
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13858
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 33257
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33258
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33259
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 33260
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 11864
Forward primer (5'-3')
TGCAGCATTTGATCTTTCAAATGG
Digested band sizes (using AluI)
Solanum pennellii LA716: 400+500
Solanum lycopersicum LA925: 850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGATTTTTGAGAGCCTGTCAATGAG
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, DraI, HinfI
  
Accessions and product sizes
Solanum pennellii LA716: 1300
Solanum lycopersicum LA925: 1300
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g37360 was used as an overgo probe on plate 13 [well H2]

Plausible BAC Matches:   P177N21,   P077J20,   P198L24,   P180P17,   P177P12,   P309I09,   P320O12,   P248O07

 Overgo Sequences

A sequence
TCGAGCATGGGAAATGGCTGATAC
B sequence
AGCTGTGGACGTTGATGTATCAGC
AB sequence
TCGAGCATGGGAAATGGCTGATACATCAAC
Marker sequence
ATGGCTTCCTCTATCTCACTTCATCAACACTCGTCTATCTATTGTCTCTT
TTCTACTCCTACTCTTCGTTTTGGCAAACACCCACATCATATCATCTCCA
TCCTTCCATCATTTCGCAAGAATTTCCTCAAATTTCATACACGTACAACA
GTACCGTTTGCTGTTACTGAATCTGATTCCCCCAAATCTCTTGAACCAAA
CCCTCAAACACTTGTACAGGAAATCGCTNNNNNGAGAGTTTTGTTCTACC
TGCAGACTTTTTTTCGCAGCTTCCCAGTGATCTTCGCTTAGATNNNNNCT
GAATGATGCAGCATTTGATCTTTCAAATGGGCCAGTTAAAGTTGAGNNNN
NTGTGGTGAAGAGGTTGGAGAGACATTGTTAAATATAAGTCGAGCATGGG
AAATGGCTGATACATCAACGTCCACAGCTTTAGTGGACAAGCTGCCTTTA
TTGGTTGGCTCATTGACAGGCTCTCAAAAATCATTAGNNNNNCATTTGGA
AGGCGCTTGTTATCAGCTGGAAAAAGGTTCCAGTCCATGGGACAATATGG
CGAAGGTGAAGTGCAGAANNNNNNGTATCTGGGGTTGATGTTGAAGAATT
TAAGCAGCAAACCAGGATGTTCAAGNNNNNTTTGGGGATCTTCAGGTTGA
ATTGACCTCTGGAAAGGCCTACACTGGAGCTGCCATTGCATTCATCTTTA
GNNNNNTTTTCTTTCTTGGGAATTGGGCCAAGGCATACAGAGCATACCGG
AGAGCTCATTACAGTATGCAAATGACAATGCTTTATTGCTTGCTAAGNNN
NNTCTCTGCGAGCATCTCTGCTTGTGATGTCCTATTCATCAACCGTTTTA
GCTGCTTTTGCAATGGTGGGACTTATTTTACTTGGGGGACAACTTAAGTC
GGAAAATAAGTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g37360  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4695 marker 4695
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)