SGN Marker CT242

SGN-M47

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
TTTTTTTTTTTTTAAATTACCATAACATACTTGTTTATGTTGTTTTTTTTTTTCTGGTACCAATGAGCTAACAAGAGTACATTTTTTTTA
GCAGAGTCCAGTTTGGTTATCAGAACCAAAAAAAGCAAAACACAAATTTCTTCATGAACTAGGAGGTACTTGCACCCATTGACCACCCTC
TCACAGCCACCTTTACAG
Reverse sequence
TTTTTTTTTTTTTAAATTACCATAACATACTTGTTTATGTTTTTTTTTTTTTTCTGGGACCAATGAGCTAACAAGAGTACATTTTTTTCA
GCAGAGTCCAGTTTGTTTATCAGAACCAAAAAAAGCAAAACACAAATTTCTTCATGAACTAGGAGGTACTTGCACCCATTGACCACCCTC
TCACAGCCACCTTTACAGCAGCTACAACACTGCGATGCCTCATTTCCGGATTCAGTCCTTGTTTCTCCCGAGCCTCGGTAGTATCTTCTA
TCTGAATGCCAACAAAATACGCGACCTTTCCTGAAGCACTTCGGATCGGTGAGATGTGAAGAAAATTCCAAAATGACGTTCCATCTTTTC
TGTAATTTAAGATATGTACAGTACACGGTTGTTCATTTTGGATGCATTGTTTTATCTGAAATTGGGTGCCTCTCTCTGTATCTTCCCCAC
TTAAAAACCGGCAATTACGACCCAATACTTCATGTCTCAAGTAGCCTATTGAAGAAAAGAATG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1463293.4e-0625 (12.6% of RFLP seq)+
SGN-U1463291.4e-48145 (73.2% of RFLP seq)+
SGN-U1497462.9e-24131 (25.5% of RFLP seq)-
SGN-U146329447 (87.1% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53765)
Chromosome
5
Position
6.10 cM
Confidence
uncalculated
Protocol
RFLP


Tomato QTL map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51887)
Chromosome
5
Position
13.62 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42337)
Chromosome
10
Position
67.40 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39031)
Chromosome
5
Position
17.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 7863)
Chromosome
10
Position
54.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7862)
Chromosome
5
Position
9.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT242 was used as an overgo probe on plate 5 [well C8]

Plausible BAC Matches:   P024H21,   P176G21,   P076K23

 Overgo Sequences

A sequence
GTACTTGCACCCATTGACCACCCT
B sequence
TAAAGGTGGCTGTGAGAGGGTGGT
AB sequence
GTACTTGCACCCATTGACCACCCTCTCACA
Marker sequence
TTTTTTTTTTTTTAAATTACCATAACATACTTGTTTATGTTGTTTTTTTT
TTTCTGGTACCAATGAGCTAACAAGAGTACATTTTTTTTAGCAGAGTCCA
GTTTGGTTATCAGAACCAAAAAAAGCAAAACACAAATTTCTTCATGAACT
AGGAGGTACTTGCACCCATTGACCACCCTCTCACAGCCACCTTTACAG
Genomic location of CT242  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D47 marker 47
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)