SGN Marker C2_At2g38730

SGN-M4700
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle309875 (SGN)
131408 (CGN)
---
Capsicum annuumSingleSGN-U198818---
Lycopersicon CombinedSingleSGN-U224513---
Solanum tuberosumSingleSGN-U253527---
ArabidopsisSingleAt2g38730 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49235)
Chromosome
1
Position
79.36 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47166)
Chromosome
1
Position
88.14 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46642)
Chromosome
1
Position
50.30 cM
Confidence
I(LOD2)
Protocol
dCAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46472)
Chromosome
1
Position
26.40 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38375)
Chromosome
1
Position
92.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39626
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
Accessions and product sizes
Solanum pennellii TA56
550
Solanum lycopersicum TA209
500
Approximate temperature
55°C
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
500
Solanum lycopersicum TA209
550
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25871)
Chromosome
2
Position
16.20 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10828
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 10829
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 10830
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13065
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13066
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13067
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13068
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 550+1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13069
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13070
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13071
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13072
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 13073
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 13074
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13075
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13076
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 580
Approximate temperature
55°C
  
PCR data   Exp. ID 13077
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 13078
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 32960
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 550+1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32961
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 32962
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32963
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 10831
Forward primer (5'-3')
AGCGGACCAAACACTAATGGATG
Digested band sizes (using amplicon difference)
Solanum pennellii LA716: 500
Solanum lycopersicum LA925: 550
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCCACATTCTCAATCTTCCTGAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
All possible enzymes for lycopersicum and pimpinellifolium: AluI
  
Accessions and product sizes
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At2g38730 was used as an overgo probe on plate 13 [well H10]

Plausible BAC Matches:   P214H10,   P246F17,   P019P03,   P194N05,   P309E12,   P061L10,   P309D12,   P309C12

 Non-Plausible BAC matches

P185G24,   P234D05,   P160N24,   P320K06

 Overgo Sequences

A sequence
CTGGTCGCATCAAGATGGAGCTTT
B sequence
GGAGTAATATCGGCGAAAAGCTCC
AB sequence
CTGGTCGCATCAAGATGGAGCTTTTCGCCG
Marker sequence
ATGGCGTCTGGCGGCGTGGGAGGAGGGGTGGTAGAATGGCACCTGAGGCC
ACAAGTACCAAAAAACCCAGTTGTATTTTTCGATGTAACAATCGGCAACA
TCCCTGCTGGTCGCATCAAGATGGAGCTTTTCGCCGATATTACTCCCAAA
ACTGCTGAGAATTTCAGGCAACTGTGCACGGGAGAATTTAGNNNNNGAAA
GCAGGAGTACCACAAGGCTTTAAGAATTGTCAGTTCCATAGGGTGATTAA
GGACTTCATGATCCAAGGTGGTGATTTCCTAAAGNNNNNGGAGATGGCAG
TGGATGTGTTTCCATATATGGAAGCAAGTTTGAGGATGAAAACTTTATTG
CCAAGCACACTGGTCCTGGCCTTTTATCAATGNNNNNGCAAATAGCGGAC
CAAACACTAATGGATGTCAGNNNNNTTTTTTGTCTCATGTGCCAAATGTG
AGTGGCTCGACAACAAGCATGTCGTTTTTGGGNNNNNCGTGTTCTTGGAG
ATGGTCTTTTAGTGGTCAGGAAGATTGAGAATGTGGCTGTTGGAGCAAAC
AACAAACCAAAGCTGGCATGTGTGATTGCTGAATGTGGAGAGATGTAA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At2g38730  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4700 marker 4700
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)