SGN Marker C2_At5g13450

SGN-M4702
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle302239 (SGN)
120502 (CGN)
---
Capsicum annuumSingleSGN-U196778---
Lycopersicon CombinedMultipleSGN-U214615---
Solanum tuberosumSingleSGN-U254610---
ArabidopsisSingleAt5g13450 on TAIR---
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49292)
Chromosome
1
Position
73.80 MB
Confidence
uncalculated
Protocol
CAPS


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47233)
Chromosome
1
Position
48.70 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Pepper-COSII   
Map version
58 (location: 41514)
Chromosome
1
Position
129.70 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43490
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38787)
Chromosome
1
Position
46.90 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39927
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
Accessions and product sizes
Solanum pennellii TA56
550
Solanum lycopersicum TA209
500
Approximate temperature
55°C
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
500
Solanum pennellii TA56
550
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27140)
Chromosome
5
Position
4.31 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11717
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 550
Approximate temperature
55°C
  
PCR data   Exp. ID 11718
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 11719
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Approximate temperature
55°C
  
PCR data   Exp. ID 13712
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13713
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13714
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13715
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13716
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13717
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13718
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13719
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13720
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 13721
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13722
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 13723
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 33207
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33208
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33209
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 33210
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 11720
Forward primer (5'-3')
AGGTTTGCTGAGTTAACCATGGC
Digested band sizes (using amplicon difference)
Solanum lycopersicum LA925: 500
Solanum pennellii LA716: 550
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCTGTTCAATGTTCACCTTCTTCCC
Enzymes
All possible enzymes for pennellii and and lycopersicum: amplicon difference
  
Accessions and product sizes
Solanum pennellii LA716: 550
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
Unigene blast matches for primers 
Overgo hybridization and physical mapping 
C2_At5g13450 was used as an overgo probe on plate 13 [well H12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGATCTCTCTGTACCTACAGAGAC
B sequence
CATGGCCTTCACTCTTGTCTCTGT
AB sequence
GGATCTCTCTGTACCTACAGAGACAAGAGT
Marker sequence
ATGGCAGGGCGTATTAGATCTACACTTCCTCACCTACGCAAAGCCCTTTC
ATCTGATTCGAGATCCGCTCTTTATCCGGCCATTATCTCCAATCCCGAGT
TGNNNNNTCAAGAAATTATGCTACTGCCCCAGCTGCCAAAGAGAAAAAAG
TAAAGNNNNNGTTCCAGTGACTATGTATGGGGTTTCTGGAAATTATGCCT
CAGCTTTGTACATCTCAGCTGTAAAAGCTAATACATTGGAGAAGGTCGAG
TCCGAGCTTTTGGACCTTATTGCGGCTTCAAAGAAAAGTCCTAAATTTTC
TCAGTTTATGAAGGATCTCTCTGTACCTACAGAGACAAGAGTGAAGGCCA
TGACTGACATCTCTTCAGAGGCTAAATTTGGAGATCTCACAAAGAACTTC
TTGGNNNNNTTGTTTTGGCTGAAAATGGGAGGCTGAAACATATTGATGCG
ATAGCAAAAAGGTTTGCTGAGTTAACCATGGCACACAAGGGGGAACTTAA
AGCCATTGTAACAACTGTTATTNNNNNCCTATTCCTCCAGAGGAGGAGAA
AGAATTGAAGGAGACATTGCAAGAGGTGATGGGAAAAGGGAAGAAGGTGA
ACATTGAACAGAAGNNNNNATTGATCCTAGCATTCTCGGTGGGCTTGTGA
TAGAATTTGGCCAGAAGGTCTTTGACATGTCAATTAGGACTAGGGCACGC
CAGATGGAGAGACTCTTGAGGGAACCTATCAACTTCTGA
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. betaceum 6002061 plant #4, AB1 chromatogram - [View]
Forward amplicon sequence for S. betaceum 6002061 plant #4, plain text
Forward amplicon sequence for S. uniloba 6002078 plant #6, AB1 chromatogram - [View]
Forward amplicon sequence for S. uniloba 6002078 plant #6, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At5g13450  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4702 marker 4702
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)