SGN Marker U144275

SGN-M4709

SynonymsNone
Locus associationsNone
Derivations 
This marker was derived from SGN unigene SGN-U144275
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 51053)
Chromosome
6
Position
41.48 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48989)
Chromosome
6
Position
77.18 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40182)
Chromosome
6
Position
67.00 cM
Confidence
CF(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14023
Forward primer (5'-3')
ATGGCAGTTAACGGTGCTTC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 1100
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCCTTCATATGTGCTGCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Solanum lycopersicum LA925: 1400
Approximate temperature
58°C
  
PCR data   Exp. ID 14023
Forward primer (5'-3')
ATGGCAGTTAACGGTGCTTC
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 600
Solanum pennellii LA716: 1100
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGCCTTCATATGTGCTGCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Solanum lycopersicum LA925: 1400
Approximate temperature
58°C
  
Genomic location of U144275  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4709 marker 4709
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)