SGN Marker C2_At1g44760

SGN-M4713
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304223 (SGN)
119913 (CGN)
---
Capsicum annuumSingleSGN-U202500---
Lycopersicon CombinedSingleSGN-U241856---
Solanum tuberosumSingleSGN-U251397---
ArabidopsisSingleAt1g44760 on TAIR---
Mapped locations  
Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46585)
Chromosome
6
Position
63.50 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46440)
Chromosome
6
Position
65.30 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper-COSII   
Map version
58 (location: 41328)
Chromosome
6
Position
62.20 cM
Confidence
F(LOD3)
Protocol
CAPS


Pepper-COSII

PCR data   Exp. ID 43304
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38180)
Chromosome
6
Position
39.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39461
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
Accessions and product sizes
Solanum lycopersicum TA209
750
Solanum pennellii TA56
750
Approximate temperature
55°C
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Digested band sizes (using amplicon difference)
Solanum lycopersicum TA209
520
Solanum pennellii TA56
300
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 25214)
Chromosome
1
Position
16.90 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 10207
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10208
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 10209
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12636
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12637
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 12638
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 12639
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12640
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 12641
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12642
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12643
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 12644
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 12645
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 12646
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 12647
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 32770
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32771
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 1000
Approximate temperature
55°C
  
PCR data   Exp. ID 32772
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 32773
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 10210
Forward primer (5'-3')
TTCTTCATCTGCTGCTCATCTTGC
Digested band sizes (using MspI)
Solanum pennellii LA716: 300
Solanum lycopersicum LA925: 520
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGAGGGTTTTTTCTGACCCAAGAC
Enzymes
All possible enzymes for pennellii and and lycopersicum: MspI, RsaI
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 130005 plant #3, plain text
Forward amplicon sequence for S. hirtum 120062 plant #28, AB1 chromatogram - [View]
Forward amplicon sequence for S. hirtum 120062 plant #28, plain text
Forward amplicon sequence for S. quitoense plant #3, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense plant #3, plain text
Forward amplicon sequence for S. quitoense SE plant #1, AB1 chromatogram - [View]
Forward amplicon sequence for S. quitoense SE plant #1, plain text

Genomic location of C2_At1g44760  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4713 marker 4713
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)