SGN Marker C2_At4g10050

SGN-M4722
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle304858 (SGN)
120724 (CGN)
---
Capsicum annuumSingleSGN-U197558---
Lycopersicon CombinedSingleSGN-U220544---
Solanum tuberosumSingleSGN-U265335---
ArabidopsisSingleAt4g10050 on TAIR---
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53429)
Chromosome
11
Position
41.55 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38626)
Chromosome
11
Position
53.70 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39812
Forward primer (5'-3')
ATCACCCTTCTGCCTTTTCTTC
Accessions and product sizes
Solanum pennellii TA56
650
Solanum lycopersicum TA209
650
Approximate temperature
55°C
Reverse primer (5'-3')
ATCTGGGATCTGAATGTCATCCTC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
300+350
Solanum lycopersicum TA209
650
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 26648)
Chromosome
4
Position
6.29 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11376
Forward primer (5'-3')
ATCACCCTTCTGCCTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGGGATCTGAATGTCATCCTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 11377
Forward primer (5'-3')
ATCACCCTTCTGCCTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGGGATCTGAATGTCATCCTC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 11378
Forward primer (5'-3')
ATCACCCTTCTGCCTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGGGATCTGAATGTCATCCTC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13387
Forward primer (5'-3')
ATCACCCTTCTGCCTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGGGATCTGAATGTCATCCTC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 13388
Forward primer (5'-3')
ATCACCCTTCTGCCTTTTCTTC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGGGATCTGAATGTCATCCTC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 650
Approximate temperature
55°C
  
PCR data   Exp. ID 11379
Forward primer (5'-3')
ATCACCCTTCTGCCTTTTCTTC
Digested band sizes (using MspI)
Solanum pennellii LA716: 350+300
Solanum lycopersicum LA925: 650
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ATCTGGGATCTGAATGTCATCCTC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, MspI, DraI, HinfI, DpnII
  
Accessions and product sizes
Solanum pennellii LA716: 650
Solanum lycopersicum LA925: 650
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At4g10050  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4722 marker 4722
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)