SGN Marker C2_At5g16710

SGN-M4725
COSII markers are Conserved Ortholog Set II - orthologs between many asterid species

SynonymsNone
Locus associationsNone
Orthologs in this COSII group 
SpeciesCopiesSequence IDCDS/Edited sequencePeptide sequencePredicted introns
CoffeeSingle301435 (SGN)
119940 (CGN)
---
Lycopersicon CombinedMultipleSGN-U214041---
Solanum tuberosumSingleSGN-U246755---
ArabidopsisSingleAt5g16710 on TAIR---
Mapped locations  
Map: Eggplant-RAD 2012   
Map version
174 (location: 132192)
Chromosome
11
Position
45.66 cM
Confidence
uncalculated
Protocol
CAPS


Eggplant-RAD 2012

Map: Tobacco N. tomentosiformis   
Map version
91 (location: 46756)
Chromosome
5
Position
84.90 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. tomentosiformis

Map: Tobacco N. acuminata   
Map version
89 (location: 46527)
Chromosome
5
Position
75.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tobacco N. acuminata

Map: Pepper Capsicum   
Map version
65 (location: 42689)
Chromosome
12
Position
0.00 cM
Confidence
uncalculated
Protocol
PCR


Pepper Capsicum

Map: Pepper-COSII   
Map version
58 (location: 41517)
Chromosome
12
Position
12.70 cM
Confidence
I(LOD2)
Protocol
PCR


Pepper-COSII

PCR data   Exp. ID 43493
Forward primer (5'-3')
TGATGAGCTGACAGCTTTCAATGAT
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
AGTGAATCTGGAATAGACCAATTCTTAT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38797)
Chromosome
11
Position
31.40 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000

PCR data   Exp. ID 39935
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
Accessions and product sizes
Solanum pennellii TA56
1400
Solanum lycopersicum TA209
1400
Approximate temperature
55°C
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Digested band sizes (using amplicon difference)
Solanum pennellii TA56
650
Solanum lycopersicum TA209
500
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Arabidopsis COSII   
Map version
44 (location: 27184)
Chromosome
5
Position
5.48 MB
Confidence
uncalculated
Protocol
CAPS


Arabidopsis COSII
Other PCR data 
PCR data   Exp. ID 11747
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 11748
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 11749
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 1400
Approximate temperature
55°C
  
PCR data   Exp. ID 13731
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Solanum tuberosum TA3427: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13732
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Solanum melongena TA2986: 450
Approximate temperature
55°C
  
PCR data   Exp. ID 13733
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Capsicum annuum TA3428: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 13734
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13735
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 100
Approximate temperature
55°C
  
PCR data   Exp. ID 13736
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 13737
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 13738
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Nicotiana plumbaginifolia TA3354: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13739
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Physalis TA1367: 700
Approximate temperature
55°C
  
PCR data   Exp. ID 13740
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Petunia axillaris TA3309: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13741
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Petunia axillaris subsp. parodii TA3310: Multiple
Approximate temperature
55°C
  
PCR data   Exp. ID 13742
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Petunia x hybrida TA3311: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13743
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Petunia integrifolia TA3312: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 13744
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Coffea canephora BP409: 350
Approximate temperature
55°C
  
PCR data   Exp. ID 33213
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3346: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 33214
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Nicotiana sylvestris TA3347: 100
Approximate temperature
55°C
  
PCR data   Exp. ID 33215
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Nicotiana tomentosiformis TA3349: 1100
Approximate temperature
55°C
  
PCR data   Exp. ID 33216
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
  
Accessions and product sizes
Nicotiana otophora TA3350: 1150
Approximate temperature
55°C
  
PCR data   Exp. ID 11750
Forward primer (5'-3')
ACTTGATGAGCTGACAGCTTTCAATG
Digested band sizes (using AluI)
Solanum pennellii LA716: 650
Solanum lycopersicum LA925: 500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AGCTTTGGTCCAAGCGACAAATC
Enzymes
All possible enzymes for pennellii and and lycopersicum: AluI, HaeIII
  
Accessions and product sizes
Solanum lycopersicum LA925: 1400
Solanum pennellii LA716: 1400
Approximate temperature
55°C
  
Unigene blast matches for primers 
Universal primers for Asterid species 
No additional PCR data found.
Other COSII sequence data 

BLASTX result of original unigene sequences against Arabidopsis protein database

Alignment of Arabidopsis CDS and edited Asterid unigenes, FASTA
Alignment of DNA and translated peptides from Arabidopsis CDS and edited Asterid unigenes, plain text
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, ClustalW
Alignment of translated peptides from Arabidopsis CDS and edited Asterid unigenes, FASTA

Input file for PAUP, NEXUS format
Phylogenetic tree
Phylogenetic tree   |   [View]

Genomic location of C2_At5g16710  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4725 marker 4725
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)