SGN Marker TG78

SGN-M479

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
TG78 image not available
Forward sequence
AAAAAAGAGATTAAAGTAATTACTGTAAAAATACAAATAAAAATCAATCTTCGTAATTGATATTAAATTTTGAAGGCTAATGTAAGACAT
GAAGATTATGAATATTAGTGTTAATTAAAATTATTTTATACTTTTAAATATTTTTTTGGCAATGAATGCAGACAATTAAGAATTTTTTGT
ATTTTTCTTCCAATAAATATTTTAAAGAGAATTATAAAAGAAAAAAAAGATAAAAGTATTAAAATTTTAAATATAAATTTTAGCCGGAGA
AGTTGACACTCCACTTCTGCCTTGCCGGCAAGTACGCAGACAATATATATAAATATACTAGATAATTTTGTTTGTGCCTAATATTTATGT
TATTATTTGTTGTATATTTCACTCATAAAGAAGTCTTATATATTATATTAATCTAGCTTATTGTTAATATATTTTTACCAGTTTTTGCTA
TTTGAAATTGCATCATATTGTTATAACAATTTTGAAC
Reverse sequence
AAAAAAGAGATTAAAGTAATTACTGTAAAAATACAAATAAAAATCAATCTTCGTAATTGATATTAAATTTTGAAGGCTAATGTAAGACAT
GAAGATTATGAATATTAGTGTTAATTAAAATTATTTTATACTTTTAAATATTTTTTTGGCAATGAATGCAGACAATTAAGAATTTTTTGT
ATTTTTCTTCCAATAAATATTTTAAAGAGAATTATAAAAGAAAAAAAAGATAAAAGTATTAAAATTTTAAATATAAATTTTAGCCGGAGA
AGTTGACACTCCACTTCTGCCTTGCCGGCAAGTACGCAGACAATATATATAAATATACTAGATAATTTTGTTTGTGCCTAATATTTATGT
TATTATTTGTTGTATATTTCACTCATAAAGAAGTCTTATATATTATATTAATCTAGCTTATTGTTAATATATTTTTACCAGTTTTTGCTA
TTTGAAATTGCATCATATTGTTATAACAATTTTGAACAT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9256)
Chromosome
1
Position
31.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9257)
Chromosome
1
Position
31.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG78 was used as an overgo probe on plate 14 [well G3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGAGAAGTTGACACTCCACTTCTG
B sequence
GTACTTGCCGGCAAGGCAGAAGTG
AB sequence
GGAGAAGTTGACACTCCACTTCTGCCTTGC
Marker sequence
AAAAAAGAGATTAAAGTAATTACTGTAAAAATACAAATAAAAATCAATCT
TCGTAATTGATATTAAATTTTGAAGGCTAATGTAAGACATGAAGATTATG
AATATTAGTGTTAATTAAAATTATTTTATACTTTTAAATATTTTTTTGGC
AATGAATGCAGACAATTAAGAATTTTTTGTATTTTTCTTCCAATAAATAT
TTTAAAGAGAATTATAAAAGAAAAAAAAGATAAAAGTATTAAAATTTTAA
ATATAAATTTTAGCCGGAGAAGTTGACACTCCACTTCTGCCTTGCCGGCA
AGTACGCAGACAATATATATAAATATACTAGATAATTTTGTTTGTGCCTA
ATATTTATGTTATTATTTGTTGTATATTTCACTCATAAAGAAGTCTTATA
TATTATATTAATCTAGCTTATTGTTAATATATTTTTACCAGTTTTTGCTA
TTTGAAATTGCATCATATTGTTATAACAATTTTGAAC
Genomic location of TG78  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D479 marker 479
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)