SGN Marker TG599

SGN-M482

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG599 image not available
Forward sequence
TGCTTTGAGACAGATGTCTCTCATTAAGTGACTGAAGCTTTCTTCTAGTTGGCTAGCATATTCATTTTCAGCATATAATCTGTATCATGA
ACAAAATTGCGACAGTATTGAATTTTTATTGTTGAATAGTCTTTTTATTATCCCCGAAGTTGAGGGTGGAACTTACATTTTCTGTTGATC
CTTGCTTGCTGTTTTTGTAAACAAAAAAGCGTCACCCATTATTTTTCTTTTATTCTTTCTAGGTTGGGACTAAGATTTTTTGAAATGAGA
AAGGTATTCGCTACCTTGAGGGCTGTGGTTGAAGTGATGGAGTATCTGAGCAAAGATGCAGCTCCTGATGGTGTGGGAAGGCTTATAAAG
GAGGAGGGAGTATTTCCTTTCATTTCTTTGTATTTCCGTGTGTGTATAGTCCGGAACTGGTTCCCTACTTATGAATTCTTTCATGGTTTG
GTCAATTGAGAAGGATCAAGAAATCTGATGCTACTTTATCATGGGAACTT
Reverse sequence
GCTTGCATGCCTGCAGAGTGGTCATACAATAAAAGGTAAAAATCAACATTCTTACCTCTGGAAAGAAACCAATAGCATTGGTCAATGATG
CTGCCTCTAGAGGAACAATATTGTATGGTGCAAGTTCCCCTGATAAAGTAGCATCAGATTTCTTGATCCTTCTCAACTGACCAAACCATG
AAAGAATTCATAAGTAGGGAACCAGTTCCGGACTATACACACACGGAAATACAAAGAAATGAAAGGAAATACTACCTCCTCCTTTATAAG
CCTTCCCACACCATCAGGAGCTGCATCTTTGCTCAGATACTCCATCACTTCAACCACAGCCCTCAAGGTAGCGAATACCTTTCTCATTTC
AAAAAATCTTAGTCCCAACCTAGAAAGAATAAAAGAAAAATAATGGGTGACGCTTTTTTGTTTACAAAAACAGCAAGCAAGGATCAACAG
AAAATCTAAGTTCCACCCTCAACTTCGGGGATAATAAAAAGACTATTCAACAATAAAAATTCAATACTGTCGCAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40107)
Chromosome
3
Position
85.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9264)
Chromosome
3
Position
64.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG599 was used as an overgo probe on plate 4 [well C1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGAGCAAAGATGCAGCTCCTGATG
B sequence
ATAAGCCTTCCCACACCATCAGGA
AB sequence
TGAGCAAAGATGCAGCTCCTGATGGTGTGG
Marker sequence
TGCTTTGAGACAGATGTCTCTCATTAAGTGACTGAAGCTTTCTTCTAGTT
GGCTAGCATATTCATTTTCAGCATATAATCTGTATCATGAACAAAATTGC
GACAGTATTGAATTTTTATTGTTGAATAGTCTTTTTATTATCCCCGAAGT
TGAGGGTGGAACTTACATTTTCTGTTGATCCTTGCTTGCTGTTTTTGTAA
ACAAAAAAGCGTCACCCATTATTTTTCTTTTATTCTTTCTAGGTTGGGAC
TAAGATTTTTTGAAATGAGAAAGGTATTCGCTACCTTGAGGGCTGTGGTT
GAAGTGATGGAGTATCTGAGCAAAGATGCAGCTCCTGATGGTGTGGGAAG
GCTTATAAAGGAGGAGGGAGTATTTCCTTTCATTTCTTTGTATTTCCGTG
TGTGTATAGTCCGGAACTGGTTCCCTACTTATGAATTCTTTCATGGTTTG
GTCAATTGAGAAGGATCAAGAAATCTGATGCTACTTTATCATGGGAACTT
Genomic location of TG599  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D482 marker 482
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)