Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker CT137

SGN-M488

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
500
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT137 image not available
Forward sequence
AACTGTATGGCACTACACTTGTGACTGGATTTGGAAGAATTTGTGGACAGCCAGTAGGGATCCTTGGAAACAATGGGATACTGTTTATGG
AATCTGCTCAGAAAGGGGCACACTTTATTGAATTGTGTACTCAACGTAACATTCCTCTGATCTTCCTTCAGAATATTACTGGATTTATGG
TTGGGTCCAAATCTGAGGCAAGTGGTATTGCCAAAGCTGGAGCTAAAATGGTAATGGCAGTCTCTTGTGCGAAGGTGCCTAAGATCACCG
TAGTTATTGGGGGAAGCTTTGGAGCTGGCAATTATGCAATGTGTGGACGTGCATATAGTCCAAATTTCATGTTCTTCTGGCCAAATGCTC
GAATATCCGTAATGGGAGGCCCTCAGGCTGCTGGAGTCCTTGCTCAAGTAGAGGGAAT
Reverse sequence
CCTTTTTCTCTTGGTGATTCCCTCTACTTGAGCAAGGACTCCAGCAGCCTGAGGGCCTCCCATTACGGATATTCGAGCATTTGGCCAGAA
GAACATGAAATTTGGACTATATGCACGTCCACACATTGCATAATTGCCAGCTCCAAAGCTTCCCCCAATAACTACGGTGATCTTAGGCAC
CTTCGCACAAGAGACTGCCATTACCATTTTAGCTCCAGCTTTGGCAATACCACTTGCCTCAGATTTGGACCCAACCATAAATCCAGTAAT
ATTCTGAAGGAAGATCAGAGGAATGTTACGTTGAGTACACAATTCAATAAAGTGTGCCCCTTTCTGAGCAGATTCCATAAACAGTATCCC
ATTGTTTCCAAGGATCCCTACTGGCTGTCCACAAATTCTTCCAAATCCAGTCACAAGTGTAGTGCCATACAGTTTCTT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1531554.4e-75141 (33.7% of RFLP seq)+
SGN-U1531551.3e-84157 (35.8% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53446)
Chromosome
1
Position
113.39 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-LXCHM 2007   
Map version
68 (location: 42950)
Chromosome
1
Position
56.20 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 43950
Forward primer (5'-3')
CTCTTGGTGATTCCCTCTACTTGA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TTGTGACTGGATTTGGAAGAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Eggplant-COSII   
Map version
63 (location: 42298)
Chromosome
1
Position
137.80 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38973)
Chromosome
1
Position
149.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9285)
Chromosome
1
Position
150.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9284)
Chromosome
1
Position
115.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT137 was used as an overgo probe on plate 5 [well C5]

Plausible BAC Matches:   P239E07

 Overgo Sequences

A sequence
TGGTTGGGTCCAAATCTGAGGCAA
B sequence
GCTTTGGCAATACCACTTGCCTCA
AB sequence
TGGTTGGGTCCAAATCTGAGGCAAGTGGTA
Marker sequence
AACTGTATGGCACTACACTTGTGACTGGATTTGGAAGAATTTGTGGACAG
CCAGTAGGGATCCTTGGAAACAATGGGATACTGTTTATGGAATCTGCTCA
GAAAGGGGCACACTTTATTGAATTGTGTACTCAACGTAACATTCCTCTGA
TCTTCCTTCAGAATATTACTGGATTTATGGTTGGGTCCAAATCTGAGGCA
AGTGGTATTGCCAAAGCTGGAGCTAAAATGGTAATGGCAGTCTCTTGTGC
GAAGGTGCCTAAGATCACCGTAGTTATTGGGGGAAGCTTTGGAGCTGGCA
ATTATGCAATGTGTGGACGTGCATATAGTCCAAATTTCATGTTCTTCTGG
CCAAATGCTCGAATATCCGTAATGGGAGGCCCTCAGGCTGCTGGAGTCCT
TGCTCAAGTAGAGGGAAT
Genomic location of CT137  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D488 marker 488
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)