SGN Marker U151109

SGN-M4904

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40192)
Chromosome
1
Position
116.60 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14032
Forward primer (5'-3')
GTTATTGGAAGGGCGACAAA
Digested band sizes (using NruI)
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 470
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GCTTGTAGCCTTGGGATATTGTCTACACCTTT
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 470
Solanum lycopersicum LA925: 470
Approximate temperature
50°C
  
PCR data   Exp. ID 14032
Forward primer (5'-3')
GTTATTGGAAGGGCGACAAA
Digested band sizes (using NruI)
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 470
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GCTTGTAGCCTTGGGATATTGTCTACACCTTT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 470
Solanum pennellii LA716: 470
Approximate temperature
50°C
  
Genomic location of U151109  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4904 marker 4904
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)