SGN Marker U150520

SGN-M4905

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40189)
Chromosome
2
Position
0.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14030
Forward primer (5'-3')
AAGCCTTCCTTCACCCCTTA
Digested band sizes (using CfoI)
Solanum pennellii LA716: 450
Solanum lycopersicum LA925: 1000
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CAGCAACAGGCAAGCAATTA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1000
Solanum lycopersicum LA925: 1000
Approximate temperature
50°C
  
PCR data   Exp. ID 14030
Forward primer (5'-3')
AAGCCTTCCTTCACCCCTTA
Digested band sizes (using CfoI)
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 450
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CAGCAACAGGCAAGCAATTA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1000
Solanum pennellii LA716: 1000
Approximate temperature
50°C
  
Genomic location of U150520  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D4905 marker 4905
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)