SGN Marker TG238

SGN-M493

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTATCGGAAACAGACTTCCTACCTTACAAAGGCAGGGGTAAGGTCATCCTTGTCCTTTTAGGCTCCACTCGTGGGATTACAAAAAATATG
TTGTGATAATGTTAAATTATGTAGTTTAGCATAAACTAGGTGCAGCCTACAGGTAAGATGAAACACCAATTAAGTTTATTTAAAAACAAG
CCTCATATACCAAAACACCTATTGATTCACTAAATAAAATAAAAGCTTTATTAGAGCAAATTCTAAGTTTGGTAAGAATAGTTTTTATGT
GTCAACTTTAAAAAAATAATCAAATATTTGGCTTGAGTTTCATGTTTCTTGGTTTTCACAAAATAACAAAAAGAAATGAATTTAGATACT
CCATATTTTTTTAGTTCATATGTACCAGCAGGAGTAATTTGAATAATATTTCAATAAGTCGTTTCAAATATCCACTATATTGTAATTTAA
TTTGTTTTAATTAAATAATGTTATAAAGCTAAAGGTTACTATTTTTCACTAAATAT
Reverse sequence
TATAGGGAGACAGTTTGCATGCCTACAGCCGATTTATCAGATTCAAAGTTAGTTACCAGGCTTGTATCTGCCTCCTTAGAATCTCGAAGA
GTTGATCCAACAATTTGCTTCACTTTTCCCTACAAAAATGAAATTTTCAGGTAAAATCTTTCAACTATCTTGAGGATATCTACAAATATG
TTATGTTAGCACCTAGAAAAAACACATCTCCCAAGCATATGAAACAAACTCAAAGCTCTTTAACCTTGAAAGGTAATTAGATAAAGAAAA
ATAGTTTGCCCCCCTCTTTGTTACTTACCTATTTGATTCAACTTCCCAAATGAAATGCTATTAAATACTGAATGAACACCAACAGTAATT
GCACGTTTTCTTCTTCTTTTTAATTCTTTCTATGCAACCAAATACATATTAGTTCTTCACTACCTGGTTTATGGTATACACATATACTTC
GCACTGCCAATGCTAAGCAGTGATGTACTAAAAATCATTTGATATGGCACAACAAGGTGGCAAGGATAAAGAAACTCCAACATTTTACTC
ATATAATATCCTAGC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39954)
Chromosome
5
Position
119.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9298)
Chromosome
5
Position
96.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG238 was used as an overgo probe on plate 3 [well G12]

Plausible BAC Matches:   P234J18

 Overgo Sequences

A sequence
GGTCATCCTTGTCCTTTTAGGCTC
B sequence
TGTAATCCCACGAGTGGAGCCTAA
AB sequence
GGTCATCCTTGTCCTTTTAGGCTCCACTCG
Marker sequence
TTATCGGAAACAGACTTCCTACCTTACAAAGGCAGGGGTAAGGTCATCCT
TGTCCTTTTAGGCTCCACTCGTGGGATTACAAAAAATATGTTGTGATAAT
GTTAAATTATGTAGTTTAGCATAAACTAGGTGCAGCCTACAGGTAAGATG
AAACACCAATTAAGTTTATTTAAAAACAAGCCTCATATACCAAAACACCT
ATTGATTCACTAAATAAAATAAAAGCTTTATTAGAGCAAATTCTAAGTTT
GGTAAGAATAGTTTTTATGTGTCAACTTTAAAAAAATAATCAAATATTTG
GCTTGAGTTTCATGTTTCTTGGTTTTCACAAAATAACAAAAAGAAATGAA
TTTAGATACTCCATATTTTTTTAGTTCATATGTACCAGCAGGAGTAATTT
GAATAATATTTCAATAAGTCGTTTCAAATATCCACTATATTGTAATTTAA
TTTGTTTTAATTAAATAATGTTATAAAGCTAAAGGTTACTATTTTTCACT
AAATAT
Genomic location of TG238  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D493 marker 493
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)