SGN Marker TG169

SGN-M495

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AAATATTGCCGAACATTGTCATCAATGATACTAACTATACATAAACCTTTGTGGAGACCTCTCCTGAGTTTGGTGTCCCTGCATTTTAAA
CTTCGATATACAGCCTACTGGACCATTATAAGCTTCGACTGCTTCCTGCTACTCATTTTGGGTCATGATAGGCACTAGACTTTTGAAAGC
AATTATACCGCGGCCATCATTGTTCGCCTTCAACGCCTTGTAAATTTTTACGAGACTGCTTGGCCAGTTCTATATTACGACACTGGTCTT
TGATATCTGCATTTCTCTCTTGATGGCGATCAAGAGAAGGATGTTCAAGATCTTTATGCAACCGCTCATACCAATCTGGATAGAAACATA
GGTCTTCATTATCTGTGTTTCTTTCCTCAT
Reverse sequence
ACATTCATGGAGAACAAATCTTTACAATTAAAAAACCTAAACGTCACGCAGCACTAAAATAGTTCTTCTAGGTTCAATAAATATTGCCAA
ACATTGTCAACAATTATACTAACTTTACATAAACCTTTGTGGAGACCTCTCCTGATTTTGGTGTCCCTGTATTTTAAACTTCAATATACA
GCCTACTGGACCATTATAAGCTTCAACTGTTTCCTGCTAATCATTTTGGGTCAAAAGAGGCACTAGACTTTTGTAGGCAATTTTAACGTG
GTCATCATTTTTCGTCTTCGTCACCTTCTAAATTTTTAGGAGACTGCTTGGCCAATTCTATATTACAACGCTGGTCTTTGTTCTCTGCAT
TTCTCTCTTTATGGTGATCAAGTGTAGTTTGTTCAAAATCTTTAGGTAACCGCTCAGACAAATCTGTATCGGAACATAGGTCTTCATTTT
CTGTTTTTCTTTCCTCATGGTAATCCTTGGGGGAGGCCGGGTCTTTCATATCCTTCTCCGCATGCTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1683673.1e-88291 (74.6% of RFLP seq)+
SGN-U168367374 (72.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXHIR 1997   
Map version
32 (location: 9304)
Chromosome
2
Position
65.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9305)
Chromosome
2
Position
77.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG169 was used as an overgo probe on plate 16 [well H5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTTGTGGAGACCTCTCCTGAGTT
B sequence
AAATGCAGGGACACCAAACTCAGG
AB sequence
CTTTGTGGAGACCTCTCCTGAGTTTGGTGT
Marker sequence
AAATATTGCCGAACATTGTCATCAATGATACTAACTATACATAAACCTTT
GTGGAGACCTCTCCTGAGTTTGGTGTCCCTGCATTTTAAACTTCGATATA
CAGCCTACTGGACCATTATAAGCTTCGACTGCTTCCTGCTACTCATTTTG
GGTCATGATAGGCACTAGACTTTTGAAAGCAATTATACCGCGGCCATCAT
TGTTCGCCTTCAACGCCTTGTAAATTTTTACGAGACTGCTTGGCCAGTTC
TATATTACGACACTGGTCTTTGATATCTGCATTTCTCTCTTGATGGCGAT
CAAGAGAAGGATGTTCAAGATCTTTATGCAACCGCTCATACCAATCTGGA
TAGAAACATAGGTCTTCATTATCTGTGTTTCTTTCCTCAT
Genomic location of TG169  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D495 marker 495
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)