SGN Marker CT82

SGN-M505

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1100
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT82 image not available
Forward sequence
CTACTGATTTAACTTTTTTTTCCTGGCATAATTCCCGGTGTATTGCCGGAGTTCAAGGGGCAAAAAACACATGCCATGTTTAACCAAAAC
AATGGGGCGACTTGCCGAAAAAAGTTATCTATTCCGAAGATATGGCAATTTATGGGGTTCTACAAGACGCTTTTAATATCAGATGGACGC
CGTCAAATTTAACGTCCTACGAACTGAAACTCAAGCCGAGGGATGATATTGACCCACCTATGAAAACTTCCGCTTCTCCGCCGACAGTGG
CTCCACCGGCTTTGCAACCTAAAGGAAGGCATCACACGGGAGTTATACAAATGTCATGGGGAAAATTT
Reverse sequence
TTTTTTTTTTCTCTCTTTTACCTTGTATACAAAACCTTCAAATACTCATAATGTATCAACTTCCCACTTCTACTGAGTTAACTTTTTTTC
CGGCAGAATATCCCGGTGTATTGCCGGAGTTCAAGTTTCAGTAGTCTCATGCCATGTTTAACCGAATCATGGGGTGACTTGCCGTTAAAA
GTTAACGATTCCGAAGATATGGTAATTTATGGGTTTCTACAAGACGCTTTTAGTATCGGATGGACGCCGTCAAATTTAACGTCCGACGAA
GTGAAACTCGAGCCGAGGGAGGAGATTGAGCCAGCTATGAGCACTTCTGTTTCTCCGCCGACAGTGGCTCCAGCGGCTTTGCAGCCTAAA
GGAAGGCATTACAGGGGCGTTAGACAAAGGCCATGGGGAAAATTTGCAGCGGAAATAAGAGATCCGGCTAAAAACGGCGCACGGGTTTGG
CTTGGAACTTACGAGTCGGCTGAGGAAGCCGCACTCGCTTATGATAAAGCCGCTTTTAGGATGCGCGGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1549813.7e-78314 (92.9% of RFLP seq)+
SGN-U1491819.3e-0629 (5.6% of RFLP seq)-
SGN-U1512465.9e-0739 (7.5% of RFLP seq)-
SGN-U1482101.5e-0756 (10.8% of RFLP seq)-
SGN-U1447901.5e-0732 (6.2% of RFLP seq)-
SGN-U1530369.6e-0958 (11.2% of RFLP seq)-
SGN-U1490606.2e-1048 (9.2% of RFLP seq)-
SGN-U1524451.6e-1065 (12.5% of RFLP seq)-
SGN-U1462264.1e-14107 (20.6% of RFLP seq)-
SGN-U1462261.7e-19148 (28.5% of RFLP seq)-
SGN-U154981481 (92.7% of RFLP seq)-
Mapped locations  
Map: Sun1642 x LA1589   
Map version
85 (location: 43658)
Chromosome
3
Position
58.10 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43516)
Chromosome
3
Position
44.00 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43058)
Chromosome
3
Position
46.20 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40732)
Chromosome
3
Position
61.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39074)
Chromosome
3
Position
75.80 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9320)
Chromosome
3
Position
56.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9323)
Chromosome
3
Position
61.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT82 was used as an overgo probe on plate 5 [well G7]

Plausible BAC Matches:   P011N20,   P174M11,   P026H13

 Overgo Sequences

A sequence
ACGTCCTACGAACTGAAACTCAAG
B sequence
CAATATCATCCCTCGGCTTGAGTT
AB sequence
ACGTCCTACGAACTGAAACTCAAGCCGAGG
Marker sequence
CTACTGATTTAACTTTTTTTTCCTGGCATAATTCCCGGTGTATTGCCGGA
GTTCAAGGGGCAAAAAACACATGCCATGTTTAACCAAAACAATNNNNCGA
CTTGCCGAAAAAAGTTATCTATTCCGAAGATATGGCAATTTATNNNNTTC
TACAAGACGCTTTTAATATCAGATGGACGCCGTCAAATTTAACGTCCTAC
GAACTGAAACTCAAGCCGAGGGATGATATTGACCCACCTATGAAAACTTC
CGCTTCTCCGCCGACAGTGGCTCCACCGGCTTTGCAACCTAAAGGAAGGC
ATCACACGGGAGTTATACAAATGTCATNNNNAAAATTT
Genomic location of CT82  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D505 marker 505
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)