SGN Marker CT83

SGN-M509

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT83 image not available
Forward sequence
CGATTGAGGATCTCATTTCAAAGAAAGCTTGAGACTGAACTGAACTTTATTTAGAACCTCAGCTAGTTTGCTTATTAGGATTATCTCGTT
TGGTTGTGTTTTACAGTTGAAGATGATGCAGTTTGCAATATTAAACTTTTGTCTAATTAAAGAACTCTGTTTCATCAGAGAGGAAGCCTC
GTGAGCTGTCTTGTTTTCGCCGAATCCTGCAATGAAATCTAAAGATATATCTAAAAAAAAAAAAAA
Reverse sequence
TTTTTTTTTTTTTTAGATATATCTTTAGATTTCATTGCAGGATTCGGCGAAAACAAGACAGCTCACGAGGCTTCCTCTCTGATGAAACAG
AGTTCTTTAATTAGACAAAAGTTTAATATTGCAAACTGCATCATCTTCAACTGTAAAACACAACCAAACGAGATAATCCTAATAAGCAAA
CTAGCTGAGGTTCTAAATAAAGTTCAGTTCAGTCTCAAGCTTTCTTTGAAATGAGATCCTCAATCG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1434745e-129231 (93.9% of RFLP seq)+
SGN-U1605675e-129231 (93.9% of RFLP seq)+
SGN-U1434745e-129231 (93.9% of RFLP seq)-
SGN-U1605675e-129231 (93.9% of RFLP seq)-
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53751)
Chromosome
6
Position
21.10 cM
Confidence
uncalculated
Protocol
RFLP

3_Methylthio_propanal_content_mta6_1 2_Isobutylthiazole_content_ibt6_1
Tomato QTL map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49349)
Chromosome
6
Position
33.75 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47285)
Chromosome
6
Position
38.98 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39075)
Chromosome
6
Position
34.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9330)
Chromosome
6
Position
31.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9334)
Chromosome
6
Position
24.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT83 was used as an overgo probe on plate 2 [well H2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCATCAGAGAGGAAGCCTCGTGAG
B sequence
GGCGAAAACAAGACAGCTCACGAG
AB sequence
TCATCAGAGAGGAAGCCTCGTGAGCTGTCT
Marker sequence
CGATTGAGGATCTCATTTCAAAGAAAGCTTGAGACTGAACTGAACTTTAT
TTAGAACCTCAGCTAGTTTGCTTATTAGGATTATCTCGTTTGGTTGTGTT
TTACAGTTGAAGATGATGCAGTTTGCAATATTAAACTTTTGTCTAATTAA
AGAACTCTGTTTCATCAGAGAGGAAGCCTCGTGAGCTGTCTTGTTTTCGC
CGAATCCTGCAATGAAATCTAAAGATATATCTAAAAAAAAAAAAAA
Genomic location of CT83  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D509 marker 509
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)