SGN Marker TG311

SGN-M513

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TGCATGCCTGCAGAGTATGGCATGGTTGCTGAGGTCGCCGTAACAGGAGATTTGTATACTTCATGGGATCCTGTTTCTGGAATTTTCACT
GGAAAAAGGCCCGCACACAAACTATTTCAAGACAATGTGACTCTGCACCTTTTCGGCAGACTGGCATTACCAGATCAAATAATGGATATT
GTTGATGGATTCGCTCTCTGTGGACAAATGACAGGAGAGGATGCTATCAACAATATAAGTAGTGAACAAATCAAGGTGCTTGGTTTCTAT
TTTCCAACTTGGGCTAG
Reverse sequence
CATTTGGCTTATGACAGAGCAGGGGATGAACACTATAATCTTATCAGCGCCCTTCACAAGTCTATGAGAGGAAGTGATGCTAATGCTTCC
ATTTATTGGCTGACGAGAATGTTGGAAGGGGGTGAAGAGCCTCTTTACATAGCAAGAAGGCTGGTCAGGTTTGCTAGTGAAGATGTGGGG
TTAGCTGATCCATCGGCTCTTGGCCAAGCTGTTGCTTGCTACCAAGCTTGCCATTTTATTGGCATGCCTGAGTGCAATGTTATCCTTGCT
CAGTGTGTTGCGTATTTGGCCTTGGCTCCGAAGTCTATTGCTGTCTATAGAGCAATGAGGGCAGCTCAAAAAGTGGTAAGAGAATCTGTT
GGTCAAAATGAAGGAGTGCCCCTTCATCTTAGGAATGCACCAACTAAGCTAATGAAGGATCTTAATTATGGGAGGGACTATATTTATCCT
CCTGACA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53266)
Chromosome
3
Position
81.40 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9342)
Chromosome
3
Position
98.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9343)
Chromosome
3
Position
49.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG311 was used as an overgo probe on plate 2 [well C10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAATGTGACTCTGCACCTTTTCGG
B sequence
TGGTAATGCCAGTCTGCCGAAAAG
AB sequence
CAATGTGACTCTGCACCTTTTCGGCAGACT
Marker sequence
TGCATGCCTGCAGAGTATGGCATGGTTGCTGAGGTCGCCGTAACAGGAGA
TTTGTATACTTCATGGGATCCTGTTTCTGGAATTTTCACTGGAAAAAGGC
CCGCACACAAACTATTTCAAGACAATGTGACTCTGCACCTTTTCGGCAGA
CTGGCATTACCAGATCAAATAATGGATATTGTTGATGGATTCGCTCTCTG
TGGACAAATGACAGGAGAGGATGCTATCAACAATATAAGTAGTGAACAAA
TCAAGGTGCTTGGTTTCTATTTTCCAACTTGGGCTAG
Genomic location of TG311  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D513 marker 513
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)