SGN Marker TG88

SGN-M515

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pUC
Cutting Site
SRD/PST1
Drug Resistance
AMP
Image
Forward sequence
GGGGGGGGGGTGAGGTCCTAATTTACGTGCTTTTGTAGTTATTCATGAGTCATGACAATCTCTTCAATGTGTTGTAAATGTCTACTTAGA
TGACGCTAGTGTTATATGTCTCAGTACTTGGATAAAACAATCTAGATCCTTGTTTAGTTCCCAAAATAGAAAAAAAGATTAAAATGCCAA
AGTGGAGAGAAAGTTCACTTTCTCATGGTCATTTAATTTATTGATTTGGAGAAAGCAAGGGGAGTAACATCCATGGTCTTAAGTACTTAT
GGATAAACTAGTGCGCGGTCTTATAAACTCAGCCGTTCATTTTGCAACCGTTATTAATATTGCAAGCTTTCTCAGTCAAAATCTTCCATG
TTCTCTTTCCAGAAGAATCCTATATGTTTGCTCTCTTCTTTCTTTTGAACTTTATGTAGTTGAAGAGGAAGTATTCTAGTGGTGTACTTT
CCTTTAGACATTTTTCGTTAGAAGATGGAAGATGGATTTTTTATAGGAAGCATATAAAATGCATATTTTT
Reverse sequence
GGGGGGGGGGTGAGGTCTTAATTTACGTGCTTTTGTAGTTATTCATGAGTCATGACAATCTCTTCAATGTGTTGTAAATGTCTACTTAGA
TGACGCTAGTGTTATATGTCTCAGTACTTGGATAAAACAATCTAGATCCTTGTTTAGTTCCCAAAATAGAAAAAAAGATTAAAATGCCAA
AGTGGAGAGAAAGTTCACTTTCTCATGGTCATTTAATTTATTGATTTGGAGAAAGCAAGGGGAGTAACATCCATGGTCTTAAGTACTTAT
GGATAAACTAGTGCGCGGTCTTATAAACTCAGCCGTTCATTTTGCAACCGTTATTAATATTGCAAGCTTTCTCAGTCAAAATCTTCCATG
TTCTCTTTCCAGAAGAATCCTATATGTTTGCTCTCTTCTTTCTTTTGAACTTTATGTAGTTGAAGAGGAAGTATTCTAGTGGTGTACTTT
CCTTTAGACATTTTTCGTTAGAAGATGGAAGATGGATTTTTTATAGGAAGCATATAAAATGCATATTTTTGCT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9344)
Chromosome
1
Position
105.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG88 was used as an overgo probe on plate 14 [well A4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AGTGCGCGGTCTTATAAACTCAGC
B sequence
GGTTGCAAAATGAACGGCTGAGTT
AB sequence
AGTGCGCGGTCTTATAAACTCAGCCGTTCA
Marker sequence
GGGGGGGGGGTGAGGTCCTAATTTACGTGCTTTTGTAGTTATTCATGAGT
CATGACAATCTCTTCAATGTGTTGTAAATGTCTACTTAGATGACGCTAGT
GTTATATGTCTCAGTACTTGGATAAAACAATCTAGATCCTTGTTTAGTTC
CCAAAATAGAAAAAAAGATTAAAATGCCAAAGTGGAGAGAAAGTTCACTT
TCTCATGGTCATTTAATTTATTGATTTGGAGAAAGCAAGGGGAGTAACAT
CCATGGTCTTAAGTACTTATGGATAAACTAGTGCGCGGTCTTATAAACTC
AGCCGTTCATTTTGCAACCGTTATTAATATTGCAAGCTTTCTCAGTCAAA
ATCTTCCATGTTCTCTTTCCAGAAGAATCCTATATGTTTGCTCTCTTCTT
TCTTTTGAACTTTATGTAGTTGAAGAGGAAGTATTCTAGTGGTGTACTTT
CCTTTAGACATTTTTCGTTAGAAGATGGAAGATGGATTTTTTATAGGAAG
CATATAAAATGCATATTTTT
Genomic location of TG88  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D515 marker 515
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)