SGN Marker TG313

SGN-M523

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1600
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG313 image not available
Forward sequence
CTCACTATAGGGAGACAGCTTGCATGCCTGCAGTATAATGACAAAGAATCAACACATAATACGTCTACTTCTCTTAACAAGCAGTTTCCA
AATGCAGCTTATATATCCTTGAAATGAGCAAAACAGAACCAGATCATATTTTTCATAATTCCATGCTTACTTCAGGAACAACACAGATGA
CACAAATAAGCAACAATATATATCAGGAAATCCATTGGCAGAAAAGCGAAAAAATAAATTTCATGGCCATCACAAACAATCACAACTGAT
TCCGAAACTTGTTTTCGGTTCACAATACGAGAAATATAAACCGCTCAGGAAAAGTATATTTTTGCATTAGCAAGTTATGAAGGTTAATTA
AACTTAAGGGCAATCAAGAGATGAACGGTCCACCTGCTTTCACATGACAAAAGCAGCAGTAAAATGAAACTAGCAAAGGAAATTTATCAG
AAAAGATTCTCTCAATCAGAATCAACTTTTCTGGATGAAGAGATCTGATTTTTATAACAAGGTAAGAAAGGACCAGCTTACCGCTAGCTC
GAAGTCACTAGACATGCCCATTGA
Reverse sequence
CTCACTATAGGGAGACAAGCCTGCATGCCTGCAGTATAATGACAAAGAATCAACACATAATACGTCTACTTCTCTTAACAAGCAGTTTCC
AAATGCAGCTTATATATCCTTGAAATGAGCAAAACAGAACCAGATCATATTTTTCATAATTCCATGCTTACTTCAGGAACAACACAGATG
ACACAAATAAGCAACAATATATATCAGGAAATCCATTGGCAGAAAAGCGAAAAAATAAATTTCATGGCCATCACAAACAATCACAACTGA
TTCCGAAACTTGTTTTCGGTTCACAATACGAGAAATATAAACCGCTCAGGAAAAGTATATTTTTGCATTAGCAAGTTATGAAGGTTAATT
AAACTTAAGGGCAATCAAGAGATGAACGGTCCACCTGCTTTCACATGACAAAAGCAGCAGTAAAATGAAACTAGCAAAGGAAATTTATCA
GAAAAGATTCTCTCAATCAGAATCAACTTTTCTGGATGAAGAGATCTGATTTTTATAACAAGGTAAGAAAGGACCAGCTTACCGCTAGCT
CGAAGTCACTAGACATGCCC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1619771.7e-1033 (5.9% of RFLP seq)+
SGN-U1468491.7e-1033 (5.9% of RFLP seq)+
SGN-U1619771.6e-0728 (5.0% of RFLP seq)-
SGN-U1468491.6e-0728 (5.0% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53267)
Chromosome
10
Position
39.60 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42439)
Chromosome
4
Position
21.90 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39992)
Chromosome
10
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9374)
Chromosome
10
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9376)
Chromosome
4
Position
0.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9375)
Chromosome
10
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9379)
Chromosome
10
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG313 was used as an overgo probe on plate 5 [well B11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P054F10,   P156M20,   P113D16,   P031K11,   P027H15

 Overgo Sequences

A sequence
GTAAGAAAGGACCAGCTTACCGCT
B sequence
CTAGTGACTTCGAGCTAGCGGTAA
AB sequence
GTAAGAAAGGACCAGCTTACCGCTAGCTCG
Marker sequence
CTCACTATAGGGAGACAGCTTGCATGCCTGCAGTATAATGACAAAGAATC
AACACATAATACGTCTACTTCTCTTAACAAGCAGTTTCCAAATGCAGCTT
ATATATCCTTGAAATGAGCAAAACAGAACCAGATCATATTTTTCATAATT
CCATGCTTACTTCAGGAACAACACAGATGACACAAATAAGCAACAATATA
TATCAGGAAATCCATTGGCAGAAAAGCGAAAAAATAAATTTCATGGCCAT
CACAAACAATCACAACTGATTCCGAAACTTGTTTTCGGTTCACAATACGA
GAAATATAAACCGCTCAGGAAAAGTATATTTTTGCATTAGCAAGTTATGA
AGGTTAATTAAACTTAAGGGCAATCAAGAGATGAACGGTCCACCTGCTTT
CACATGACAAAAGCAGCAGTAAAATGAAACTAGCAAAGGAAATTTATCAG
AAAAGATTCTCTCAATCAGAATCAACTTTTCTGGATGAAGAGATCTGATT
TTTATAACAAGGTAAGAAAGGACCAGCTTACCGCTAGCTCGAAGTCACTA
GACATGCCCATTGA
Genomic location of TG313  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D523 marker 523
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)