SGN Marker CT219

SGN-M525

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2200
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT219 image not available
Forward sequence
CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATGGGAAAAACCTTTTTATACCCTGGGTTAAAAAACCCCCAACTG
GGTTTTTTTTCCGTTAATCTGCCAAAGGACCTAAAATTCCCTAGTACCAAAAAAGGGTGTTTTTTTTTTTTCCCCCCAAAATTTTAGGAA
ATTTCCTTTCCCCCCCAAAAGCCCCGCATACAAAAACGATTTCTCCCTTTGAAAAAGGCCCAACAAAAAAAAAATGGGCCTGGCCAAAGG
CATACTCCTTTTCCATAAAAATGGCCGAAAAAAAAC
Reverse sequence
TTTTTTTTTTGAAATAGTCATCGGCGGCACCTCAACAGAGCAACAATGGCGACACCGGCGACTACTTCTTTCGCCATTTCCACCTCCTCT
TCCTCGGCCGTTTCTTCCTCAAGCAAATCATTGAAGCGTGCTCTTTCCAGTAACTTAGGGTTCCTTTCTACTTCTTCTCTGTCGCTTAAG
GCTCTCAGAGCTAAATCTTACTCCTACAATGTGTCTAGCTCCGGCGGACCACTTAGTGTTCGTATGGTTGCTGCTCCTGCTGCTGTGAAG
GCACCGATGTCTCTCGATTTTGAAACGTCTGTTTTTAAGAAGGAGAAAGTTACCCTTTCTGGACACGACGAGTACATTGTGAAAGGAGGG
AGAGATTTGTTCAAGTTGTTGCCGGATGCATTCAAGGGAATCAAGCAGATTGGAGTCATTGGCTGGGGTTCTCAGGGACCAGCTCAAGCC
CAGAACTTGAGGGATTCTCTTGCAGAAGCAAATTCTGATATAGTCGTTAAGATTGGTTTGAGAAAGGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1438041.3e-72233 (45.0% of RFLP seq)-
SGN-U143805503 (97.1% of RFLP seq)-
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42329)
Chromosome
10
Position
41.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 9386)
Chromosome
10
Position
33.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9385)
Chromosome
12
Position
38.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT219 was used as an overgo probe on plate 16 [well H11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCCTTTGAAAAAGGCCCAACAAAA
B sequence
GCCAGGCCCATTTTTTTTTTGTTG
AB sequence
CCCTTTGAAAAAGGCCCAACAAAAAAAAAA
Marker sequence
CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATGGG
AAAAACCTTTTTATACCCTGGGTTAAAAAACCCCCAACTGGGTTTTTTTT
CCGTTAATCTGCCAAAGGACCTAAAATTCCCTAGTACCAAAAAAGGGTGT
TTTTTTTTTTTCCCCCCAAAATTTTAGGAAATTTCCTTTCCCCCCCAAAA
GCCCCGCATACAAAAACGATTTCTCCCTTTGAAAAAGGCCCAACAAAAAA
AAAATGGGCCTGGCCAAAGGCATACTCCTTTTCCATAAAAATGGCCGAAA
AAAAAC
Genomic location of CT219  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D525 marker 525
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)