Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker TG249

SGN-M531

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTGTCAGTCTGGATGATGTCAAAGAAGCAATGCAATGTAAGCATTTGGCTTATGACAGAGCAGGGGATGAACACTATAATCTTATCAGCG
CCCTTCACAAGTCTATGAGAGGAAGTGATGCTAATGCTTCCATTTATTGGCTGACGAGAATGTTGGAAGGGGGTGAAGAGCCTCTTTACA
TAGCAAGAAGGCTGGTCAGGTTTGCTAGTGAAGATGTGGGGTTAGCTGATCCATCGGCTCTTGGCCAAGCTGTTGCTTGCTACCAAGCTT
GCCATTTTATTGGCATGCCTGAGTGCAATGTTATCCTTGCTCAGTGTGTTGCGTATTTGGCCTTGGCTCCGAAGTCTATTGCTGTCTATA
GAGCAATGAGGGCAGCTCAAAAAGTGGTAAGAGAATCTGTTGGTCAAAATGAAGGAGTGCCCCTTCATCTTAGGAATGCACCAACTAAGC
TAATGAAGGATCTTAATTATGGGAGGGACTATATTTATCCTCCTG
Reverse sequence
GGGAGACAGCTTGCATGCCTGCAGAGTATGGCATGGTTGCTGAGGTCGCCGTAACAGGAGATTTGTATAGTTATGGGATCCTGTTTCTGG
AATTTTCACTGGAAAAAGGCCCGCAGACAAACTATTTCAAGACAATGTGACTCTGCACCTTTTCGTCAGACTGGCATTACCAGATCAAAT
AATGGATATTGTTGATGGATTCGCTCTCTGTGGAGAAATGACAGGAGAGGATGCTAACAAGAATATAAGTAGTGAACAGATCAAGTGCTT
GGTTTCTATTTTCCAACTTGGGCTAGCATGTTCAGCAGAAACACCACAAGAGAGAATTAACATGGAGCAAGTTTACAGGGAATTGATAAT
AATCAGGACAGGTTTCTGAAGTAACAGGAACACACTGCTAAGCAGTCCCTAGAAACCGCTCACAGAAAAGCTTGATTGAGTTAATAGTTA
CGAATTGTCTTATGTGTGGTCAATCTCAGATATCAACTTATACTGTACTTTACACATATGGCAGTAATATTTTTTTTCTCCCAGATGATA
AAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39961)
Chromosome
3
Position
140.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9402)
Chromosome
3
Position
98.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG249 was used as an overgo probe on plate 2 [well B8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TAGCAAGAAGGCTGGTCAGGTTTG
B sequence
CCCACATCTTCACTAGCAAACCTG
AB sequence
TAGCAAGAAGGCTGGTCAGGTTTGCTAGTG
Marker sequence
TTGTCAGTCTGGATGATGTCAAAGAAGCAATGCAATGTAAGCATTTGGCT
TATGACAGAGCAGGGGATGAACACTATAATCTTATCAGCGCCCTTCACAA
GTCTATGAGAGGAAGTGATGCTAATGCTTCCATTTATTGGCTGACGAGAA
TGTTGGAAGGGGGTGAAGAGCCTCTTTACATAGCAAGAAGGCTGGTCAGG
TTTGCTAGTGAAGATGTGGGGTTAGCTGATCCATCGGCTCTTGGCCAAGC
TGTTGCTTGCTACCAAGCTTGCCATTTTATTGGCATGCCTGAGTGCAATG
TTATCCTTGCTCAGTGTGTTGCGTATTTGGCCTTGGCTCCGAAGTCTATT
GCTGTCTATAGAGCAATGAGGGCAGCTCAAAAAGTGGTAAGAGAATCTGT
TGGTCAAAATGAAGGAGTGCCCCTTCATCTTAGGAATGCACCAACTAAGC
TAATGAAGGATCTTAATTATGGGAGGGACTATATTTATCCTCCTG
Genomic location of TG249  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D531 marker 531
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)