SGN Marker CT90

SGN-M537

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT90 image not available
Forward sequence
CTTTTTTTTTTTTTTTGTTTTTTTTTTTAACATCAAGCATAACCAAAATAAATAGATCCAAAATTTTGGTAGGTCACGCCTTTAACAAAC
TCAACTAAAACAAATGCAAAATTTTAGAAGACTAGAATCCATATTCTGACAGGAAATCCGAAATGAAACAAAGGCTAAGCTCCAGGGAAC
TCTGTCTCTGCCTCAGCCACTGTTTCTTCAGCGGGTCGATCCAAATTCACACCAACATCTTCTGAATAGGCACCATGCACCTCCATCAGC
TTGCCAAGATCGAATTTAGGGGCCTTCAGGATACTTCACTTTGCGAATATAAACATTTTGGAGTGGAAAAATGCTTGAAGAAGCTTTCTC
AATCTCTCTACCAATTGATTCAGGGATGAACTTTGCTACCAACTCCTTCAGGTCACAGGAACTTGCTTGGTTTCTCATGATCTCAACCAT
CTTGCGACGGATCTGACGGATCTGGCTGCTCTGAGCATAACATGTACGCTTCT
Reverse sequence
CCATATGCTAAGAAGGATTGGTATGACATTAAGGCACCATCAGTTTTTGAAATCAAGAACGTTGGCAAAACCCTCGTCACTAGGACTCAG
GGTACTAAGATTGCTTCCGAAGGACTGAAGCACAGAGTTTTTGAAGTCAGTTTAGCTGATCTTCAGAAGGATGAGGATCAGGCTTTCAGG
AAGATCCGCTTGAGAGCAGAAGATGTGCAAGGGAGGAATGTCCTCACAAACTTCCATGGGATGGACTTCACAACAGACAAGTTGAGGTCT
CTGGTGCGCAAGTGGCAGACTTTGATTGAGGCTCATGTGGATGTCAAGACTACAGATAGCTACACTCTTAGGATGTTCTGCATTGCTTTT
ACAAAGAAGCGTCCAAACCAACAGAAGCGTACATGTTATGCTCAGAGCAGCCAGATCCGTCAGATCCGTCGCAAGATGGTTGAGATCATG
AGAAACCAAGCAAGTTCCTGTGACCTGAAGGAGTTGGTAGCAAAGTTCATCCCTGAATCAATTGGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1609141.5e-1053 (10.5% of RFLP seq)+
SGN-U1440352.6e-18186 (37.0% of RFLP seq)+
SGN-U1433754e-88339 (67.4% of RFLP seq)+
SGN-U143376475 (94.4% of RFLP seq)+
SGN-U1440353.8e-0849 (9.5% of RFLP seq)-
SGN-U1609153.8e-0849 (9.5% of RFLP seq)-
SGN-U1609163.8e-0849 (9.5% of RFLP seq)-
SGN-U1609149.6e-09146 (28.3% of RFLP seq)-
SGN-U1609141.7e-16159 (30.8% of RFLP seq)-
SGN-U1609153.1e-30362 (70.2% of RFLP seq)-
SGN-U1440358e-31363 (70.3% of RFLP seq)-
SGN-U1604987.4e-99297 (57.6% of RFLP seq)-
SGN-U1604975e-100247 (47.9% of RFLP seq)-
SGN-U1433751e-180506 (98.1% of RFLP seq)-
SGN-U143376516 (100.0% of RFLP seq)-
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42365)
Chromosome
3
Position
87.00 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39080)
Chromosome
3
Position
76.50 cM
Confidence
F(LOD3)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39081)
Chromosome
6
Position
66.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9413)
Chromosome
3
Position
94.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9411)
Chromosome
3
Position
58.80 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9412)
Chromosome
6
Position
60.10 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT90 was used as an overgo probe on plate 2 [well A1]

Plausible BAC Matches:   P123A05

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CTTTGCTACCAACTCCTTCAGGTC
B sequence
CCAAGCAAGTTCCTGTGACCTGAA
AB sequence
CTTTGCTACCAACTCCTTCAGGTCACAGGA
Marker sequence
CTTTTTTTTTTTTTTTGTTTTTTTTTTTAACATCAAGCATAACCAAAATA
AATAGATCCAAAATTTTGGTAGGTCACGCCTTTAACAAACTCAACTAAAA
CAAATGCAAAATTTTAGAAGACTAGAATCCATATTCTGACAGGAAATCCG
AAATGAAACAAAGGCTAAGCTCCAGGGAACTCTGTCTCTGCCTCAGCCAC
TGTTTCTTCAGCGGGTCGATCCAAATTCACACCAACATCTTCTGAATAGG
CACCATGCACCTCCATCAGCTTGCCAAGATCGAATTTAGGGGCCTTCAGG
ATACTTCACTTTGCGAATATAAACATTTTGGAGTGGAAAAATGCTTGAAG
AAGCTTTCTCAATCTCTCTACCAATTGATTCAGGGATGAACTTTGCTACC
AACTCCTTCAGGTCACAGGAACTTGCTTGGTTTCTCATGATCTCAACCAT
CTTGCGACGGATCTGACGGATCTGGCTGCTCTGAGCATAACATGTACGCT
TCT
Genomic location of CT90  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D537 marker 537
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)