SGN Marker CT151

SGN-M545

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT151 image not available
Forward sequence
TGCCGTGAAGATGATGAACTTTTTCTCAATTCCAATTCCCAGCAGCTTGTAAATCATGATGGAAATGGTTTTCATCATATTCTGCCTCAA
TCAGAAACTTCTTTCCTGAGCGGTATAAAGCAACGGCTGCTTTCATATATATTTCGAGGCATATGGAATGAAGCTGACCAAACCATGAGA
GTGCAGTGCCTGAAGAAGAAGTTTTACTTCCACTTTCAAGATTACATTGACTTGATTATCTGGAAGGTGCAGTTTTTGGACCGACATCAC
CTGTTGATCAAGTTTGGCAGTGTTGATGGTGGGGTATCCCGAAATGCTGACATCCATCCTTCTTTTTTTGCTGTTTACAATATGGAGACT
ACTGAAATTGGTGCATCTTATCAGAACTCAGCCGATGAGCTTTATTTCTTGTTCTAGCTGTTCAGCGAC
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1527583e-141280 (65.3% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9431)
Chromosome
1
Position
22.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT151 was used as an overgo probe on plate 14 [well C8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P238I13,   P211G05,   P159L11,   P017L24,   P336M04,   P262N19,   P094L23,   P260D07,   P006E23,   P223D02,   P223D15,   P103N19,   P197K06,   P274H08,   P299C22,   P311M10,   P265P12,   P279H04,   P079E01,   P299E04,   P264L01

 Overgo Sequences

A sequence
CGAGGCATATGGAATGAAGCTGAC
B sequence
GCACTCTCATGGTTTGGTCAGCTT
AB sequence
CGAGGCATATGGAATGAAGCTGACCAAACC
Marker sequence
TGCCGTGAAGATGATGAACTTTTTCTCAATTCCAATTCCCAGCAGCTTGT
AAATCATGATGGAAATGGTTTTCATCATATTCTGCCTCAATCAGAAACTT
CTTTCCTGAGCGGTATAAAGCAACGGCTGCTTTCATATATATTTCGAGGC
ATATGGAATGAAGCTGACCAAACCATGAGAGTGCAGTGCCTGAAGAAGAA
GTTTTACTTCCACTTTCAAGATTACATTGACTTGATTATCTGGAAGGTGC
AGTTTTTGGACCGACATCACCTGTTGATCAAGTTTGGCAGTGTTGATGGT
GGGGTATCCCGAAATGCTGACATCCATCCTTCTTTTTTTGCTGTTTACAA
TATGGAGACTACTGAAATTGGTGCATCTTATCAGAACTCAGCCGATGAGC
TTTATTTCTTGTTCTAGCTGTTCAGCGAC
Genomic location of CT151  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D545 marker 545
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)