Notice: The FTP site is available again. We apologize for any inconvenience.

SGN Marker CT224

SGN-M547

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
TCCTTTAACTGCTTCCTGAAGGATTGCTTTTGTTGTAAAATCGAATGCAGTTGAAAGTTGTCCCGCGCCATCAATCCAATTGATGATTCT
TTGCCTGTGACTATCTTGGTTGTAATCCAAATTGCTGCCCTTGTAATTGCAAGTGTCCCAGTATTCTCCAACTGCAAATATTGGCTTAGC
TCCCTCGATATATTCCTTTACATACTTCGAAGCATAACCTTTGGCAAAATCAAAACGAAAATCTTGGAAGCCAACAGAGGATCTTAGCCA
CCGCATCCAGTCAATGAGATCTTTCCGGACAAAGGATTGTGTATGATCTATATTTGGAAATCCGTTAAAGTTGTCTCCAGTGCTTTTGTT
ACCCCTTCCACCAGTGCAAGATGTAATAGCATGTTCATCCCAAGACATAGGAATTCCTTTTTTTTTTTTTTTAAACTAAAAGTTGGTTTC
AAAGTAGATAAAAATAAAGTATTCTCAACAAGACGGGAGCAAACATAAGCAACTG
Reverse sequence
TTTTTTTTTTTTTTTTTTTGGCGCCTACGGTAGGCAATCTGAACCTCCTCAGCCAAATTGGCCAAGTTAAGCATGTGAGAGAAAGCTTTA
GCAATAACAATTGAATCCCCTGGATCCAAACTTGTCAACACATTGCCAAGTTCCTCCAGCTTCTTCGGATCATGCTTGGCTTCATACTCG
GCAGAAAGCTCATAACAATCTTGGACTGTTCCTTTGAGATCCTCTCCATGCAAATCTTGAAGAATATCAAGAAACCTATCCAAAAGCAAA
GCATCATACTCAACAAGTTTATCATCTTCAGAAACTTTAGCAGGCACCAGTTGCCTCAACTGTGCATCAATTGAAGCAAGTTTCTCCAAA
TTCTTAGCAGCCATTTCTCCATCTCTCTCAGCAGAGTCCAGCCAGCCATGGGTATCGATCTGAAGGCCGGAGGTAAGAGTAAGAAGACTA
AGCGTACCGCCCCTAAGTCTGACGATGTTTACCTCAAGCTCCTCGTCAAGCTTTACCGATTCTTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1689941.6e-1338 (7.5% of RFLP seq)+
SGN-U1609671.8e-2273 (14.5% of RFLP seq)+
SGN-U1441442e-3473 (14.5% of RFLP seq)+
SGN-U1665311e-162288 (57.0% of RFLP seq)+
SGN-U1447803.8e-08105 (20.4% of RFLP seq)-
SGN-U1612503.8e-08105 (20.4% of RFLP seq)-
SGN-U1612493.8e-08105 (20.4% of RFLP seq)-
SGN-U1592967.1e-22320 (62.1% of RFLP seq)-
SGN-U1441449.3e-80149 (28.9% of RFLP seq)-
SGN-U1595759.3e-80313 (60.8% of RFLP seq)-
SGN-U1596641.6e-87330 (64.1% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51884)
Chromosome
1
Position
87.40 cM
Confidence
uncalculated
Protocol
unknown
Subscript
A

MQTL_1_Late_blight_1 MQTL_2_Late_blight_1
Potato meta-QTL consensus map

Map: Potato meta-QTL consensus map   
Map version
107 (location: 51883)
Chromosome
4
Position
74.91 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9434)
Chromosome
1
Position
87.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9435)
Chromosome
4
Position
119.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT224 was used as an overgo probe on plate 15 [well E5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AAGCCAACAGAGGATCTTAGCCAC
B sequence
TCATTGACTGGATGCGGTGGCTAA
AB sequence
AAGCCAACAGAGGATCTTAGCCACCGCATC
Marker sequence
TCCTTTAACTGCTTCCTGAAGGATTGCTTTTGTTGTAAAATCGAATGCAG
TTGAAAGTTGTCCCGCGCCATCAATCCAATTGATGATTCTTTGCCTGTGA
CTATCTTGGTTGTAATCCAAATTGCTGCCCTTGTAATTGCAAGTGTCCCA
GTATTCTCCAACTGCAAATATTGGCTTAGCTCCCTCGATATATTCCTTTA
CATACTTCGAAGCATAACCTTTGGCAAAATCAAAACGAAAATCTTGGAAG
CCAACAGAGGATCTTAGCCACCGCATCCAGTCAATGAGATCTTTCCGGAC
AAAGGATTGTGTATGATCTATATTTGGAAATCCGTTAAAGTTGTCTCCAG
TGCTTTTGTTACCCCTTCCACCAGTGCAAGATGTAATAGCATGTTCATCC
CAAGACATAGGAATTCCTTTTTTTTTTTTTTTAAACTAAAAGTTGGTTTC
AAAGTAGATAAAAATAAAGTATTCTCAACAAGACGGGAGCAAACATAAGC
AACTG
Genomic location of CT224  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D547 marker 547
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)