SGN Marker CT225

SGN-M548

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
900
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTTTTTCTGCATATATCACCATAAATTTAACAATCATCAATTCAAAAGAAGTACTAATATTACACAAGAAGAACCATTTCTATAGCTACT
TTTATTCCTCTTTCTCCTATTATAGTAACCCCATAACCATTCCACTCTCAATGATATACTTGTCCAAAAGAAAGTTGAGTACTATAATAT
ATATGGAGCTCAAACATGTAAAGCTCATGACAAGGTTCAAAAGTGACGCGGCCCTTCAAGATAGAGGCTTCAGCCATCGTTAGAATTCAC
TGACTATTTGACACACAAGTTGAAGCATCACCCTGGCCAGATTGAGGCTGCTGCTATTATGGAACACATTTTGGATGGAAGCTCTTATGT
CAAGGCAGCTCAGAAGCTCCATGAAATGGATCCTCTTCAAAAACCAAAGCAAGATCGTTATGCTCTTCGAACATCTCCACAGTGGCTTGG
ACCTCAAATTGAAGTCATCCGTGCAGCAACTAAGATGATTGAGAGAGAG
Reverse sequence
ACATCTTGGTTGTGTTGCTCAGCACTTTGGACATGGTTAGTCACTGGATTTGCAAGGAATTGAAGTTCTGAGCAGTAAGAAGCCATTGCA
ATTTCAGCTCCCTTGAGTCCATAATCCAAGCTTGGATTCCTTCCTGCTGTGAGATTAGATGGCAACCCATTGTTGTAATAGTCGTTGACA
AGTTCCGAAAATTGGGCAAACATCAATTTCCCAATAGATGCAAGGGCCAATCTTGTATTATCCATGGACACACCAATAGGGGTACCTTGG
AAGTTTCCACCGTGTAAGGCCTTGTTTCTTGAAACATCGATCAATGGGTTGTCGTTCACTGAGTTAATCTCTCTCTCAATCATCTTAGTT
GCTGCACGGATGACTTCAATTTGAGGTCCAAGCCACTGTGGAGATGTTCGAAGAGCATAACGATCTTGCTTCGGTTTTTGA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1605949.6e-1235 (7.0% of RFLP seq)+
SGN-U1475976.9e-59230 (46.1% of RFLP seq)+
SGN-U1435013e-132237 (47.5% of RFLP seq)+
SGN-U1435021e-63154 (34.9% of RFLP seq)-
SGN-U1475973e-116434 (98.4% of RFLP seq)-
SGN-U143501441 (100.0% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51885)
Chromosome
5
Position
45.91 cM
Confidence
uncalculated
Protocol
unknown
Subscript
B

MQTL_1_Late_blight_5 MQTL_1_Maturity_5 MQTL_2_Late_blight_5
Potato meta-QTL consensus map

Map: Pepper-AC99   
Map version
34 (location: 9441)
Chromosome
9
Position
36.00 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
A


Pepper-AC99

Map: Pepper-AC99   
Map version
34 (location: 9439)
Chromosome
3
Position
86.94 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
B


Pepper-AC99

Map: Pepper-AC99   
Map version
34 (location: 9440)
Chromosome
9
Position
38.37 cM
Confidence
uncalculated
Protocol
RFLP
Subscript
C


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9438)
Chromosome
9
Position
4.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9436)
Chromosome
3
Position
49.30 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9437)
Chromosome
7
Position
34.00 cM
Confidence
I
Protocol
RFLP
Subscript
C


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT225 was used as an overgo probe on plate 4 [well C3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TTGAAGCATCACCCTGGCCAGATT
B sequence
TAATAGCAGCAGCCTCAATCTGGC
AB sequence
TTGAAGCATCACCCTGGCCAGATTGAGGCT
Marker sequence
CTTTTTCTGCATATATCACCATAAATTTAACAATCATCAATTCAAAAGAA
GTACTAATATTACACAAGAAGAACCATTTCTATAGCTACTTTTATTCCTC
TTTCTCCTATTATAGTAACCCCATAACCATTCCACTCTCAATGATATACT
TGTCCAAAAGAAAGTTGAGTACTATAATATATATGGAGCTCAAACATGTA
AAGCTCATGACAAGGTTCAAAAGTGACGCGGCCCTTCAAGATAGAGGCTT
CAGCCATCGTTAGAATTCACTGACTATTTGACACACAAGTTGAAGCATCA
CCCTGGCCAGATTGAGGCTGCTGCTATTATGGAACACATTTTGGATGGAA
GCTCTTATGTCAAGGCAGCTCAGAAGCTCCATGAAATGGATCCTCTTCAA
AAACCAAAGCAAGATCGTTATGCTCTTCGAACATCTCCACAGTGGCTTGG
ACCTCAAATTGAAGTCATCCGTGCAGCAACTAAGATGATTGAGAGAGAG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of CT225  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D548 marker 548
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)