SGN Marker CT227

SGN-M553

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT227 image not available
Forward sequence
CTTTTTTTTTTTTTTTACACAAAACAAACACACTTTTATAAATAGACGCAACAGGAACAGAAACCAACAACATGACACAATTCAAAGTGC
AGAAACATAAAAGGCTTCTGGTGGAACACCAAAAGGCAAGACTAGTTGAGAAATTGCACACAGACGTTGCAAATCCCAACAGACACAAGT
TTGGACGTATAAGTCCATTATTCTGAGAAAACAACAGACACTTTAAAAAAAAAAAAA
Reverse sequence
TTTTTTTTTTTTTAAAGTGTCTGTTGTTTTCTCAAAATAATGGACTTATACGTCCAAACTTGTGTCTGTTGGGATTTGCAACGTCTGTGT
GCAATTTCTCAACTAGTCTTGCCTTTTGGTGTTCCACCAAAAGCCTTTTATGTTTCTGCACTTTGAATTGTGTCATGTTGTTGGTTTCTG
TTCCTGTTGCGTCTATTTATAAAAGTGTGTTTGTTTTGTGTAAAAAAAAAAAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1699298e-23197 (83.1% of RFLP seq)+
SGN-U1603113.8e-74187 (78.9% of RFLP seq)+
SGN-U1431374e-114206 (86.9% of RFLP seq)+
SGN-U1699294.7e-18197 (83.5% of RFLP seq)-
SGN-U1603113.8e-74187 (79.2% of RFLP seq)-
SGN-U1431372e-109206 (87.3% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39023)
Chromosome
5
Position
43.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
CT227 was used as an overgo probe on plate 11 [well F12]

Plausible BAC Matches:   P161M16,   P157F14

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CACACAGACGTTGCAAATCCCAAC
B sequence
GTCCAAACTTGTGTCTGTTGGGAT
AB sequence
CACACAGACGTTGCAAATCCCAACAGACAC
Marker sequence
CTTTTTTTTTTTTTTTACACAAAACAAACACACTTTTATAAATAGACGCA
ACAGGAACAGAAACCAACAACATGACACAATTCAAAGTGCAGAAACATAA
AAGGCTTCTGGTGGAACACCAAAAGGCAAGACTAGTTGAGAAATTGCACA
CAGACGTTGCAAATCCCAACAGACACAAGTTTGGACGTATAAGTCCATTA
TTCTGAGAAAACAACAGACACTTTAAAAAAAAAAAAA
Genomic location of CT227  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D553 marker 553
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)