SGN Marker CA515649

SGN-M5541

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 13956)
Chromosome
2
Position
29.39 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34380
Forward primer (5'-3')
TCTCCAATTTCCATTCGGAG
Accessions and product sizes
Capsicum annuum NuMex-RNaky
190
Capsicum frutescens BG2814-6
190
Approximate temperature
Unknown
Reverse primer (5'-3')
TAATCGCATTTGCGAACTTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Istvan Nagy
Organization: Agricultural Biotechnology Center Hungary
Genomic location of CA515649  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5541 marker 5541
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)