SGN Marker TG187

SGN-M562

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1050
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG187 image not available
Forward sequence
AATATCAACAGGAATAAATCAAATATCCAATCCATGATCTCAGAATATAAAATAAAGCTAAGATCCTATATTTCTTTTTATAATTGGGCC
AGCTTGCCCGCACCTCAACTAATTCCACGAGGTATCTGCTACATCCCACCAGCACAAGTACCAAATAACTCTGAGCATCTCTACTCTTGA
GAAAAACGTGGAAAACATATTGCCGGCACCACCAGCACATGTTTTCTTAGAAAATATGTGGTCTTATTTTCTGTTTTAGTTAGTGAGTAG
AAAATACTTTCCACCGTATGGTTGCTGAGGAGAAAAACAAATTTCCAACAATCTATACATTTTCATAGGATAATCAATACAAAATATCAG
AATTTAAAGTGAAAAAAAGATGAGATTTAAGGAGTAAGTTTTAGAAGCAACATTATTACTCCCTCCGTTTCAATGTGAGTGTCTTAGTTT
GACTAGACACGTTCTTTAAAAAAATAAGGGAGACCTGAATCTTGTGGTCTTAAA
Reverse sequence
ACTCACTATAGGGAGACAGCCTGCATGCCTGACAGTAGACTTCTATTTCATAAATTAATTGGGCTGTACTGTACACTGCCTTCTTTGTAT
TTTTGTTGTGTTTACTATTATGGTCTCCTTTTTCCTTTATTTTTTATTTCTGTGTCATCAAAATATTTTGATAACTAAACTTTCTCAAAA
TGATATTTTGATAAATAATGGTAATTTTATTGACGAAATAACAAAAACAGATGGTAATTTTACTGAATAACACTCCACTGTGAAGCTGGT
ACTGAACCAGTACAAGAGAAAGCTGTTAGAATCCTTTTATAGCTTTTTTGGGGTCATCAAGACCACTTGTGGAAGTCTATTTTTATTATT
TAGTTTGAAGTCAATTTTTTATTATTTAGTTTGAAGTCGATCTTTTACTGAACATTACCAAAAACCTACTTTCTCAAGACATGCCACAGA
ACACACAAAAGCCAATGTATTGATGATGGCTGCTGCAACCCATAAACCTACTGCCTTGTAATACTTATATTTTTTTTTTTTTTGATAAAG
TAACATTGTAATATTTATAATAT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPEN 1992   
Map version
28 (location: 9483)
Chromosome
2
Position
0.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG187 was used as an overgo probe on plate 16 [well B8]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P101H17,   P216E11,   P313N06,   P138C11,   P066L01,   P150P17,   P006G12,   P289L17,   P186F02,   P197P05,   P270M21,   P272O14,   P018H01,   P328F01,   P252G10,   P329J17,   P122D23,   P073O15,   P070P02,   P141B09,   P124H17,   P001B24,   P128D16

 Overgo Sequences

A sequence
CCGCACCTCAACTAATTCCACGAG
B sequence
GGGATGTAGCAGATACCTCGTGGA
AB sequence
CCGCACCTCAACTAATTCCACGAGGTATCT
Marker sequence
AATATCAACAGGAATAAATCAAATATCCAATCCATGATCTCAGAATATAA
AATAAAGCTAAGATCCTATATTTCTTTTTATAATTGGGCCAGCTTGCCCG
CACCTCAACTAATTCCACGAGGTATCTGCTACATCCCACCAGCACAAGTA
CCAAATAACTCTGAGCATCTCTACTCTTGAGAAAAACGTGGAAAACATAT
TGCCGGCACCACCAGCACATGTTTTCTTAGAAAATATGTGGTCTTATTTT
CTGTTTTAGTTAGTGAGTAGAAAATACTTTCCACCGTATGGTTGCTGAGG
AGAAAAACAAATTTCCAACAATCTATACATTTTCATAGGATAATCAATAC
AAAATATCAGAATTTAAAGTGAAAAAAAGATGAGATTTAAGGAGTAAGTT
TTAGAAGCAACATTATTACTCCCTCCGTTTCAATGTGAGTGTCTTAGTTT
GACTAGACACGTTCTTTAAAAAAATAAGGGAGACCTGAATCTTGTGGTCT
TAAA
Genomic location of TG187  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D562 marker 562
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)