SGN Marker Hpms2-45

SGN-M5739

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41609)
Chromosome
5
Position
56.40 cM
Confidence
F(LOD3)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43577
Forward primer (5'-3')
CGAAAGGTAGTTTTGGGCCTTTG
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TGGGCCCAATATGCTTAAGAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14184)
Chromosome
5
Position
60.29 cM
Confidence
uncalculated
Protocol
unknown


Pepper-FAO3

PCR data   Exp. ID 34762
Forward primer (5'-3')
CGAAAGGTAGTTTTGGGCCTTTG
Accessions and product sizes
Capsicum annuum NuMex-RNaky
148
Capsicum frutescens BG2814-6
148
Approximate temperature
Unknown
Reverse primer (5'-3')
TGGGCCCAATATGCTTAAGAGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of Hpms2-45  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5739 marker 5739
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)