SGN Marker TG572

SGN-M58

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TGCTGCTCATGCGGATAAAAATGGCCGTCGGAAGTTGGCTGCCATGCTTGTTGAACATGAACCACGTTCATCTAAGCAGGTTTTGTTAAT
TCTTTTAAATGCCTTTTGTCTTTCTATTAATATCCTTTTTTTGGAACTCTTTCATGTTTACTGATGGAGCCTAGAACTTCTTATCTCTTA
ATGATAGATGTTCTCATCTAAGGGAACTTCTTTGTTCTTCGCTGGCTTTAATCTGTTGATTGGATTTCTGTGACCAAAATGTACGACATG
GTTAGCTTTCATTAGCTTGTGGTGCACTAACTACGTTATTCCTCTAGGTTCCTCTCTTGCTAAGCATTGGAGAAGAGGATACTGCTCTAA
TGAAGTCAACTGAAAGTGGTGATACTGATTTAGTTTATCTTGTCCTGTTCCACATCTGGCAAAAGGTACATATAAACACCGGTCTGGAGT
AGATTTTCTTGTAACCCAAGTCCTTTTTTTCCTTTCTAAACTACTAGTTGGTTCAGTTATTAATAACCACATGCTTTTTTTCCCCCAGAG
ACCAGCTTTGGATTTCTTTGGGACAATACAGGCCAGACCTCTAGCTCGTGATTTGTTTGT
Reverse sequence
CTAGCACACTGGACTTATATGATAGGAAGGCTTTTCTTACCGGTTAGAAATGTTATCAGGTGCCTAAAACTAAGCCTAATGCACACTCAG
CATCACTCAGAAGAAGCAATTGAATAGACCATCAACTCAAGACAACAAGCAGGAACAAAAAAAAAGAGAAGCAAGAGCAAGCAAAAGAAA
TAATGAAACAGCTCCACTGAATCATCAACTCAATGACTTGATAACTAATACTGAAGGAAATGGCACCTTAACAATTTTGCATGCTCTTCA
GCAGCTTTTGATTCAAAAAAATTTTCCTTTGTTTCTACAAATAGATGCTGGGCCTTCTCAATGAGTTTTACTCTTGGACCATGAAGTGGA
GATCCTTTGCTAGCCATGGGATTCTTAGACAATTCCCATGACTCTTTCCATAACAGAAAAGCTACATCCTACAACATTGAAACTTTGTCA
GATAGCGAAAGTTGAATGAAGGAAAAGTAGAGAGAATCGCCATGAACTGTATAAATACTAGCTTTTTTTAGCAGCAAAATTTACATGTCT
TGACAATTTAAGCTTAAAAAAGATACAGCAGACAGGATTATAGAGCAATTACACGGGATTCCAGAAGTAGGCAAATTGAAAAATTGTTAA
AAGAGTTCCTACATAAAAATTATTGGTAAATAACTCCTACAATATTCTTTTACCAAATTCCATCTACTAAGAAATATAAATGTAAGGATA
TGAGCACAATATCCAAATTAAAAATTGATAATAGTTCCTAGA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1707981.2e-3270 (9.2% of RFLP seq)-
SGN-U1707989.9e-55107 (14.0% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53359)
Chromosome
7
Position
22.16 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_7 MQTL_1_Late_blight_7
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50410)
Chromosome
7
Position
61.39 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48342)
Chromosome
7
Position
49.56 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40091)
Chromosome
7
Position
48.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7894)
Chromosome
7
Position
52.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7898)
Chromosome
7
Position
32.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG572 was used as an overgo probe on plate 8 [well D5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P071A18,   P076I21,   P061C06,   P019C11,   P107G18,   P312E01,   P254L12,   P264B09,   P199P13,   P034C12

 Overgo Sequences

A sequence
GAGAATGATAGAGGCGAAATGCCG
B sequence
CTGCGGGCTCAAATATCGGCATTT
AB sequence
GAGAATGATAGAGGCGAAATGCCGATATTT
Marker sequence
TCCTTGAGCTTTTCGTCCACCATGTTCACAGCTGATTTAATATGAGAAAA
TCCCTCATCAAGTAAACTCGTGATATCAATTTTATGCTGAGAATGATAGA
GGCGAAATGCCGATATTTGAGCCCGCAGCTTCTCTTCTGAAAGAATCTGC
ATGTTTGTCCTTTCAGTAATTAATACAAACACTGGTGCTTATATTCCATT
TCAGAAAAACAAAATTCGTACTTTCTGTTTTTCCAGTGCGCGCACTTTTT
TCTTCAAGTGATTTTCTATTTCAAGACCCTGAAAACCAACACAATTTTTT
TTAAAAAAAAAAAAGAGAGAGAGAGAAGAGAGCAATGAAATGATTAAGAA
TAGAGTAGAACAATAAGTTCCTGCAATATTGAACAAAGAGCAGATGAGAA
ACTACATACTACTTGTAGCTTGTTCTGAAGATTATCCAAAGATTTTCGTA
GTGTCTCCAC
Genomic location of TG572  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D58 marker 58
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)