SGN Marker CT168

SGN-M582

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
600
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
CTTTTTTTTTTTTTTTAAAACAAAATCAATCTGGGTGTATATTTTACCTTTTCAAAACACCATCTGAAATAAATGTATATAGGATATGAA
CCGAAACCAAACTGGGAAAATGGATTCTAATGGAACTATAGGATATGTATTCAAGTCACAAATTATCTTCATTTTCAATCATATCGCGTT
CCTCACTATCGACTACATATGTTTTGTGGCCGCCAATTACTTCCGCTTGTTTCTTCCCATCCCTCCATAACTGTATG
Reverse sequence
ACTTGGATTTTAAGGTGAGAGTTCAGGTTTTGGAAAATCATGATGGAGAAAGTTCTGTACAAGATCTTGATGATTCACCTGCTTCGATTG
AGCTACAACACATTTCTGATGAACCCCAATTTGATCGAGTTATAGCTGAAGCACAACAGCTTGATGAATCTATTGTGATTCTATGGATGG
CAAACTGGTGCCGCAAATGCATATACTTGAAACCAAAATTGGAAAAACTGGCTGCTGACTACTTCCCAAGAACACGCTTTTACTCTGTTG
ATGTCAATAATGTTCCACACAAGCTTGTGGTTCGCGCTGGAGTAACTAAAATGCCGACCATACAGTTATGGAGGGATGGGAAGAAACAAG
CGGAAGTAATTGGCGGCCACAAAGCATATGTAGTCGTTAGTGAGGTACGCGATATGATTGAAAATGAAGATAATTTGTGACTTGAAGACA
TATCCTATACTTCCATTAGAATCCATTTTCCCAGTTTTGTTCTGGTTCATATCCTATATACATTTACTTCAGATGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1532944e-102241 (93.8% of RFLP seq)+
SGN-U1468893.9e-0853 (10.1% of RFLP seq)-
SGN-U153294526 (100.0% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51867)
Chromosome
11
Position
18.64 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38989)
Chromosome
11
Position
20.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9536)
Chromosome
11
Position
14.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9537)
Chromosome
11
Position
20.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 9535)
Chromosome
11
Position
2.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
CT168 was used as an overgo probe on plate 9 [well G12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCGCGTTCCTCACTATCGACTACA
B sequence
GCGGCCACAAAACATATGTAGTCG
AB sequence
TCGCGTTCCTCACTATCGACTACATATGTT
Marker sequence
CTTTTTTTTTTTTTTTAAAACAAAATCAATCTGGGTGTATATTTTACCTT
TTCAAAACACCATCTGAAATAAATGTATATAGGATATGAACCGAAACCAA
ACTGGGAAAATGGATTCTAATGGAACTATAGGATATGTATTCAAGTCACA
AATTATCTTCATTTTCAATCATATCGCGTTCCTCACTATCGACTACATAT
GTTTTGTGGCCGCCAATTACTTCCGCTTGTTTCTTCCCATCCCTCCATAA
CTGTATG
Genomic location of CT168  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D582 marker 582
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)