Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

SGN Marker Hpms1-172

SGN-M5829

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-FAO3   
Map version
31 (location: 14292)
Chromosome
7
Position
15.68 cM
Confidence
uncalculated
Protocol
unknown


Pepper-FAO3

PCR data   Exp. ID 34683
Forward primer (5'-3')
GGGTTTGCATGATCTAAGCATTTT
Accessions and product sizes
Capsicum annuum NuMex-RNaky
344
Capsicum frutescens BG2814-6
344
Approximate temperature
Unknown
Reverse primer (5'-3')
CGCTGGAATGCATTGTCAAAGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of Hpms1-172  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5829 marker 5829
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)