SGN Marker TG197

SGN-M591

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1520
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
CTGTACTACGAGAATTAAGGCATGGTTTTACTTGTGTATCTTCATATCCACTTATTTGCTCCTCTAAATTATGAACTTTACTGATTGACT
TTCAGGAGAACATTTCTTGAGCATGACTAGTAATATACTTCTTGAGCCTGCCACAGAAGAAAACATGTTTTATGGTCATCACATGACTCA
TGGTCCATAATATGCATACTCATGCAAGCCCCTACCATGCATGTGTTGTCAGGATTGCCTACTGCTCTTTCAGCAGGTCTCATCTTGTTT
CCTGTGGCACCAGACAAAAAGAATTTGCTTGCTTTAAATACGTGCAAGTATGACAAGCTTGGAAGATAGCTCTCGCAAATAAAGTAGAAA
TGGGGAGGCCGACACTTTTACCTTTATTGGTCTTTTGTCCTCATCTCCCCCACACATTTTCCTTTCGCTATGAAGTAAATCGTGAATGCC
TTGAAACTTACACTTGCTTTCAGTTAAGACTGACTCTATTGACATAATTTCAGATC
Reverse sequence
TAAGAAAAAAACAGACCTCACAAAAAAGAAAATTAAAGTAGCTGCCTTACTTGACGGACTGCGTGGGTTGCTGTGGCAGTTAATGCCATC
ACTGGAACATCTGGAAAATTTTGCTTAAGACATCCTAATACTCTATAATCTGGTCGAAAATCATGTCCCCACTGGCTGAGAAACAAGTAA
AAGAACAGATCAAATATACCTTAAATTAGCTAAAACCATTGACAAGATCTTGCCTATTGTTTTTTCTATTTCTCAGATTATTTGATACAG
GAACTGCATAATTTCCAATCACTTTCGTGATTCTTTTCACCAAACATATAAGAACGCCCAAAACTATGCATTCAAAAAAGTAAGATTGAC
ACAAGTCAACAACAACAACAAGAACATAGAGTTTCTTGATGGCTTTCCTGTCCCCTCATCTGATACATCAGTTTGCACTATTGTATTTTT
ACCATTTTTCCTTCTGAACAGTTAAAGATGATTTAGAATAAGGGCATACCTC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1679333.5e-0528 (5.6% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39937)
Chromosome
1
Position
116.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9559)
Chromosome
1
Position
84.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG197 was used as an overgo probe on plate 3 [well A8]

Plausible BAC Matches:   P238I01,   P213K05,   P149B02,   P143L15,   P010F03,   P311L09,   P105P17

 Overgo Sequences

A sequence
CCATGCATGTGTTGTCAGGATTGC
B sequence
GCTGAAAGAGCAGTAGGCAATCCT
AB sequence
CCATGCATGTGTTGTCAGGATTGCCTACTG
Marker sequence
CTGTACTACGAGAATTAAGGCATGGTTTTACTTGTGTATCTTCATATCCA
CTTATTTGCTCCTCTAAATTATGAACTTTACTGATTGACTTTCAGGAGAA
CATTTCTTGAGCATGACTAGTAATATACTTCTTGAGCCTGCCACAGAAGA
AAACATGTTTTATGGTCATCACATGACTCATGGTCCATAATATGCATACT
CATGCAAGCCCCTACCATGCATGTGTTGTCAGGATTGCCTACTGCTCTTT
CAGCAGGTCTCATCTTGTTTCCTGTGGCACCAGACAAAAAGAATTTGCTT
GCTTTAAATACGTGCAAGTATGACAAGCTTGGAAGATAGCTCTCGCAAAT
AAAGTAGAAAT
Genomic location of TG197  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D591 marker 591
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)