SGN Marker CA526211

SGN-M5925

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Pepper-COSII   
Map version
58 (location: 41560)
Chromosome
1
Position
133.50 cM
Confidence
I(LOD2)
Protocol
SSR


Pepper-COSII

PCR data   Exp. ID 43536
Forward primer (5'-3')
TTGGGGACTTCACGTCTCTC
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
TTGATGATAAATCCTCCCCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Pepper-FAO3   
Map version
31 (location: 14408)
Chromosome
8
Position
104.98 cM
Confidence
uncalculated
Protocol
SSR


Pepper-FAO3

PCR data   Exp. ID 34709
Forward primer (5'-3')
TTGGGGACTTCACGTCTCTC
Accessions and product sizes
Capsicum annuum NuMex-RNaky
175
Capsicum frutescens BG2814-6
175
Approximate temperature
Unknown
Reverse primer (5'-3')
TTGATGATAAATCCTCCCCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Marker Submitted By 
Name: Istvan Nagy
Organization: Agricultural Biotechnology Center Hungary
Genomic location of CA526211  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D5925 marker 5925
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)