SGN Marker CT243

SGN-M594

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
800
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
TCCCCCGGTGCTGCAGGAATTCCTTTTTTTTTTCTTTCTCATACTATTACTTCCAGATCAACGACAATGGCTGCTACCGACAATGTCAAC
AATAACTCCGTTTCCAAGCCTTCTCTTTACCTTCACAACATGGATGAGGTGCAAAAAGTGTTTCAACGGCTCGACACGAACGGCGACAGC
ATGATATCCGGCGAAGAGCTCTCCGGCGTCATCAGTGCTCTTGGATCTGGTACATCTCCTGAAGAAGTCTCTCGGATGATGAATGAAATT
GATTCTGACAGAGACGGATTCATTAGCCTTCAGGAATTTGCTGAGATCTGTAAAGGCGACATTAACACCATCAGTGACGGTGGCGTTATG
GAGCTTCCTGAAGCGTTTGATCTGTACGATCAGGACAGTAACCGATTGATCTCCGCCGCTGAGCTTCATCAGATCCTGACTCGTTTATGC
GACAACTGCTC
Reverse sequence
TTTTTTTTTTTTTTTTTTTTTTAAACTAAAATTTCATATCACATTAAATTCAGAATCCACATTTACTGTTAACGGCGTTACCCTAACAAA
TTCATCTTAAAGTTTATCCTTACGGTTTCTCCGTCTATCATCAGTTAGAGGTAGAAACTATATCCTATAAAGGGGACGCACTATAATCCC
GTGCACCTCACCTTTATCAGCCGCTAAAAAGGGATAGTAAAACAAAGACTAGAAAGAGCCTACTTGCTGGTAGTCATCATCTTCTTAAAC
TCTTCAAAGCTAACGTAACCGTCGCCGTCGGAATCAACGGAGTTGATCATTTTGGTACAGTCCTGAACGGAGCAGTTTTCGCCTAAACGA
GTCAGGATCTGATGAAGCTCAGCGGCGGAGATCAATCCGTTACTGTCCTGATCGTACAGATCAAACGCTTCACGAAGCTCCCTAACGCCA
CCGTCACCGATGCTGTTAATGTCGCCTTTACAGAACTCAGCAAATTCCTGAAGGCTAATGA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U143175404 (87.6% of RFLP seq)+
SGN-U1450832.3e-0646 (9.0% of RFLP seq)-
SGN-U1603343e-141300 (58.7% of RFLP seq)-
SGN-U1431674e-156301 (58.9% of RFLP seq)-
SGN-U143175489 (95.7% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 51888)
Chromosome
3
Position
74.14 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_3 MQTL_2_Late_blight_3 MQTL_3_Late_blight_3
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49337)
Chromosome
3
Position
61.68 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47274)
Chromosome
3
Position
107.56 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42338)
Chromosome
3
Position
136.80 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39032)
Chromosome
3
Position
141.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 9567)
Chromosome
3
Position
99.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 9569)
Chromosome
3
Position
147.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9568)
Chromosome
3
Position
106.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT243 was used as an overgo probe on plate 4 [well E10]

Plausible BAC Matches:   P107H18,   P254C04,   P248I01,   P039A11,   P222O03,   P196B23,   P029M12,   P251O08,   P196C12,   P116P23,   P053P05,   P277F19,   P074J07,   P092C14

 Overgo Sequences

A sequence
TGCTCTTGGATCTGGTACATCTCC
B sequence
CCGAGAGACTTCTTCAGGAGATGT
AB sequence
TGCTCTTGGATCTGGTACATCTCCTGAAGA
Marker sequence
TCCCCCGGTGCTGCAGGAATTCCTTTTTTTTTTCTTTCTCATACTATTAC
TTCCAGATCAACGACAATGGCTGCTACCGACAATGTCAACAATAACTCCG
TTTCCAAGCCTTCTCTTTACCTTCACAACATGGATGAGGTGCAAAAAGTG
TTTCAACGGCTCGACACGAACGGCGACAGCATGATATCCGGCGAAGAGCT
CTCCGGCGTCATCAGTGCTCTTGGATCTGGTACATCTCCTGAAGAAGTCT
CTCGGATGATGAATGAAATTGATTCTGACAGAGACGGATTCATTAGCCTT
CAGGAATTTGCTGAGATCTGTAAAGGCGACATTAACACCATCAGTGACGG
TGGCGTTATGGAGCTTCCTGAAGCGTTTGATCTGTACGATCAGGACAGTA
ACCGATTGATCTCCGCCGCTGAGCTTCATCAGATCCTGACTCGTTTATGC
GACAACTGCTC
Genomic location of CT243  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D594 marker 594
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)