SGN Marker CT170

SGN-M595

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT170 image not available
Forward sequence
TTCATAAATAGTGATATAGATCATTTCATATATAGCTTAAAGTTTGTCCTAAATACATCTAATGGAACATTAGTATCATTTTAAGGGCTC
ACTCACGTAATTTTTTTCTCAAATGATCAAACTAATAGAACTCATAAAATTAGACAAGTGGAACCTTTTTACGAGTTAGGACATCATTGA
TATGCTGGGCCTGGGAATATGCGCTCACGACTTGTTATCTTCTTTCAGCA
Reverse sequence
CTAGAATCTCTGTCCAATATGTGCTGAAAGAAGATAACAAGTCGTGAGCGCATATTCCCAGGCCCAGCATATCAATGATGTACTAACTCG
TAAAAAGGTTCGACTTGTCTAATTTTATGAGTTCTATTAGTTTGATCATTTGAGAAAAAAATTACGTGAGTGAGCCCTTAAAATGATATT
AATGTTCTATTAGATGTATTTTGGACAAACTTTAAGCTATATATGAAATGATCTATATCACTATTTATGAAAAAAAAAAAAAAAAAA
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1690227.7e-60123 (53.5% of RFLP seq)+
SGN-U1690224.5e-77144 (53.9% of RFLP seq)-
Mapped locations  
Map: Tomato-EXHIR 1997   
Map version
32 (location: 9573)
Chromosome
3
Position
85.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9574)
Chromosome
3
Position
90.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT170 was used as an overgo probe on plate 4 [well D5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P109F22,   P141E07,   P057G21,   P025J05,   P004G12,   P320F03,   P332M01,   P198E12,   P252K15,   P018J05,   P064D11

 Overgo Sequences

A sequence
CATTGATATGCTGGGCCTGGGAAT
B sequence
CAAGTCGTGAGCGCATATTCCCAG
AB sequence
CATTGATATGCTGGGCCTGGGAATATGCGC
Marker sequence
TTCATAAATAGTGATATAGATCATTTCATATATAGCTTAAAGTTTGTCCT
AAATACATCTAATGGAACATTAGTATCATTTTAAGGGCTCACTCACGTAA
TTTTTTTCTCAAATGATCAAACTAATAGAACTCATAAAATTAGACAAGTG
GAACCTTTTTACGAGTTAGGACATCATTGATATGCTGGGCCTGGGAATAT
GCGCTCACGACTTGTTATCTTCTTTCAGCA
Genomic location of CT170  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D595 marker 595
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)