SGN Marker CT244

SGN-M597

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT244 image not available
Forward sequence
CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGATTCACTGACTTTGCATTCATTCAACCTTAATAATTGCCCCAAAACAAAAATTTAT
CTAGCAAAAAAATAATTATCATCCATTGCTTTTTTAATTCTCCAAACAGCTAAAAAAGTTATAAAATCTTTTAATCTAACCAAACGATAG
ATAGTTCGATTGATGAACTCAGCCATCGAACCCGGGCTGGCTCCACACAACATCTCGGACCCGGCTCAAGTCCCCACCCTTTAACGTACG
GGCCACACCTTCAAACACCGAATGAGCGTTCAAATTCCGGCTCCCAACAATGTATTCATGCGGAGGAACCATCTCCCAGTCATGATCATC
AACACCATCGTCCAAGTCATGGAACGATTCAACCGAGTTAACTCCGTATATTTTAGACCAATCAAGGACATTCACAGGTGCTGACCTGGC
CATGAGTGCCA
Reverse sequence
TATAACATTAAATCACAATAATACATCCAGATTATCTGACTTTTCTAAAAAAATTGCGTCGCCGGAGCCCCAAAATTCCAGGTAACCCAT
AGAAAAAATTTTGTTCATACATAGAAATTTTTTCTTTTCTGACGCCTGAAAATTAAAAAAAGGCGATGATACATGGCAAAGGGTCGGAAA
CTGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1450995.7e-87258 (56.0% of RFLP seq)+
SGN-U1451007e-179428 (92.8% of RFLP seq)+
SGN-U1451001.5e-23184 (100.0% of RFLP seq)-
Mapped locations  
Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43508)
Chromosome
2
Position
48.40 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43049)
Chromosome
2
Position
59.90 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42339)
Chromosome
2
Position
56.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39033)
Chromosome
2
Position
64.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 9580)
Chromosome
2
Position
52.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9579)
Chromosome
2
Position
63.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
CT244 was used as an overgo probe on plate 16 [well C9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCACACCTTCAAACACCGAATGAG
B sequence
AGCCGGAATTTGAACGCTCATTCG
AB sequence
CCACACCTTCAAACACCGAATGAGCGTTCA
Marker sequence
CTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGATTCACTGACTTTGCA
TTCATTCAACCTTAATAATTGCCCCAAAACAAAAATTTATCTAGCAAAAA
AATAATTATCATCCATTGCTTTTTTAATTCTCCAAACAGCTAAAAAAGTT
ATAAAATCTTTTAATCTAACCAAACGATAGATAGTTCGATTGATGAACTC
AGCCATCGAACCCGGGCTGGCTCCACACAACATCTCGGACCCGGCTCAAG
TCCCCACCCTTTAACGTACGGGCCACACCTTCAAACACCGAATGAGCGTT
CAAATTCCGGCTCCCAACAATGTATTCATGCGGAGGAACCATCTCCCAGT
CATGATCATCAACACCATCGTCCAAGTCATGGAACGATTCAACCGAGTTA
ACTCCGTATATTTTAGACCAATCAAGGACATTCACAGGTGCTGACCTGGC
CATGAGTGCCA
Genomic location of CT244  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D597 marker 597
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)