SGN Marker CT178

SGN-M608

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
300
Vector
pBLUESC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
CT178 image not available
Forward sequence
TCTTGTCATAACATATAGTATTTGTTGTGTGCTGATCAATCTATCCTTTAATTAATACGTACTCAGCATGCACCTAAATAATTTGTATGT
GTGTTACACTACTCTTGTCTTTGATGTTGTGCACCTACTTTAATTTGCATGAGTGTGAATAATATTACGTATATTGTTTTTCTTAAAAAA
AAAAAAAAAAAAAA
Reverse sequence
not available
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1434113.4e-46115 (59.3% of RFLP seq)+
SGN-U1434121.3e-79168 (86.6% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53455)
Chromosome
4
Position
61.77 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49324)
Chromosome
4
Position
56.18 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47262)
Chromosome
4
Position
58.06 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43640)
Chromosome
4
Position
79.30 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43501)
Chromosome
4
Position
48.00 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43040)
Chromosome
4
Position
67.10 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40743)
Chromosome
4
Position
72.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 38997)
Chromosome
4
Position
74.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 9610)
Chromosome
4
Position
50.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 9614)
Chromosome
4
Position
51.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
CT178 was used as an overgo probe on plate 1 [well D1]

Plausible BAC Matches:   P111N23

 Overgo Sequences

A sequence
GTGTGTTACACTACTCTTGTCTTT
B sequence
GTAGGTGCACAACATCAAAGACAA
AB sequence
GTGTGTTACACTACTCTTGTCTTTGATGTT
Marker sequence
TCTTGTCATAACATATAGTATTTGTTGTGTGCTGATCAATCTATCCTTTA
ATTAATACGTACTCAGCATGCACCTAAATAATTTGTATGTGTGTTACACT
ACTCTTGTCTTTGATGTTGTGCACCTACTTTAATTTGCATGAGTGTGAAT
AATATTACGTATATTGTTTTTCTTAAAAAAAAAAAAAAAAAAAA
Genomic location of CT178  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D608 marker 608
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)